Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Clone Read LE_HBa0009O22_SP6_4554

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0009O22_SP6_4554
Primer
SP6
ID from Seq. Facility
LE_HBa_009_O22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
656 trimmed for vector and quality, 813 raw
Genbank Accession
Sequence
>LE_HBa0009O22_SP6_4554 (raw untrimmed)
AAAGGGCGGTCTCANCTNTNATCGAATCTCATTTAGGGGGGCATTTGGATTTGCTGTAATTGCAACTTTAACCCTTTTCTGCTTTGATGAATCCAGCAGG
GATTTAACTTGTAAAGTGAACTTATCTTTTGTTTCTGGTTGAATTTGACTTTCAGGTGAAAGTAGGAATGTCGCCAGTTTATCAGGTTGAAAGGAAGTTA
GGTAAAGGTGGGTTTGGTCAGGTCTTTTTGGGTCGTCGTCTTTCTGGTGGAAATGAATCTTCAAATGGTCAAGGGGCTGTTGAGGTATGTGCTTGGTCTC
CCCCTTCCCCTCTCACTGCCTATGCTAGACAATTTGTTTTCCACAAGTAATATTAGGGGATTTTACTCTCACTGGTTTATCTTTATGGCTCCAGGTTGCA
CTGAAATTTGAGCATATGAAAAGCAAAGGCTGTAACTATGGTCCTCCACATGAGTGGCAAGTTTACAAGTATGGATATGGACCTCTTTTGGAGTGAATGG
GTGCTCATTTTAGAATATGATTCTAACTAGACTAAACTTGTTTTGTTGAGCAGTACTCTTGGAGGCAGCCATGGAGTGCCTAGCGTGCATTATAAAGGGA
GGGTAGGAGACTATTACGTAATGGTATGTGTAGTAAAGTTATGTTTTTTTCCATTAAGTGTGTAGCAGAATTATGCTTCTGCCATTAATATTAATTGGTA
TAACCATTAAGATTGGTAAACTATAACTTTTAACAGTTAAGTTGGCGTTTGAGTCAAAAATTCAAATTAGCTGTTGACTGGTGGAAATCAATGTCGCATC
CCAAAGGATTATG
>LE_HBa0009O22_SP6_4554 (trimmed for quality and cloning vector)
GGCATTTGGATTTGCTGTAATTGCAACTTTAACCCTTTTCTGCTTTGATGAATCCAGCAGGGATTTAACTTGTAAAGTGAACTTATCTTTTGTTTCTGGT
TGAATTTGACTTTCAGGTGAAAGTAGGAATGTCGCCAGTTTATCAGGTTGAAAGGAAGTTAGGTAAAGGTGGGTTTGGTCAGGTCTTTTTGGGTCGTCGT
CTTTCTGGTGGAAATGAATCTTCAAATGGTCAAGGGGCTGTTGAGGTATGTGCTTGGTCTCCCCCTTCCCCTCTCACTGCCTATGCTAGACAATTTGTTT
TCCACAAGTAATATTAGGGGATTTTACTCTCACTGGTTTATCTTTATGGCTCCAGGTTGCACTGAAATTTGAGCATATGAAAAGCAAAGGCTGTAACTAT
GGTCCTCCACATGAGTGGCAAGTTTACAAGTATGGATATGGACCTCTTTTGGAGTGAATGGGTGCTCATTTTAGAATATGATTCTAACTAGACTAAACTT
GTTTTGTTGAGCAGTACTCTTGGAGGCAGCCATGGAGTGCCTAGCGTGCATTATAAAGGGAGGGTAGGAGACTATTACGTAATGGTATGTGTAGTAAAGT
TATGTTTTTTTCCATTAAGTGTGTAGCAGAATTATGCTTCTGCCATTAATATTAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.957032
Expected error %
0.174597
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g13670.1 Score 70 E Value 6e-18 Identity 67.10% Align. Length 482bp (73.48%) Frame 1
68416.m01722 protein kinase family protein contains Pfam domains, PF00069: Protein kinase domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g25760.2 Score 55 E Value 4e-16 Identity 84.60% Align. Length 237bp (36.13%) Frame 3
68415.m03092 protein kinase family protein contains protein kinase domain, Pfam:PF00069
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM51279.1| Score 70 E Value 3e-16 Identity 67.10% Align. Length 482bp (73.48%) Frame 1
putative casein kinase [Arabidopsis thaliana] gb|AAL85021.1| putative casein kinase [Arabidopsis thaliana] dbj|BAB01914.1| casein kinase-like protein [Arabidopsis thaliana] ref|NP_187977.1| protein kinase family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD73330.1| Score 55 E Value 4e-22 Identity 63.80% Align. Length 470bp (71.65%) Frame 1
putative serine/threonine protein kinase [Oryza sativa (japonica cultivar-group)] dbj|BAD73223.1| putative serine/threonine protein kinase [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0009O22
Clone
Clone name
hba-9o22
LE_HBa0009O22
P009O22
Clone type
BAC
Contamination
none
Estimated length
119,413
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found