Clone Read LE_HBa0057O20_SP6_45638

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057O20_SP6_45638
Primer
SP6
ID from Seq. Facility
LE_HBa_057_O20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
761 trimmed for vector and quality, 860 raw
Sequence
>LE_HBa0057O20_SP6_45638 (raw untrimmed)
AAAAGTTTTTCNNNNTACTAGTGTAGAGGGAGCAATAATGTGGCTAAAGCAAATATAGAATGGTTTGATGGGCTAAATTTTGACAGTGAAATGTGAGGTA
GTTTCTGTTGCAGACAGTATGATTTAACCAGCTCAGTGAGACAATGTGAAGCATGAAATTCTGGAAATACTGGTTTCTCTAGGTATACAACTTTTCTGAA
TCTTCAAGATTTCATTAGACATTGAGGATGTCAAGTTACATCATCACTACTGTTCTATTTGGGTGACTATATTATCTGAGACTAGTGGTTTCTTGTTGCC
ACTTAACTTGTTTTCCATTTAGTGCATGGGAGCACAAGCCCCAGTGGTGCTTGTAGCTTTGATCCATGTGTAACTGTATATATGCCTTCACTGGATGTAA
GTGTTTTTAGTTGGTCATCTCCTAAAAGGAATCAATGCTGTTTCTTATTTCTGACGGAATTTCTGATTGTCCAGACCTCCAGGACTCCAGTTGCGGTTCA
GTGAATTCTCTCAAGGGTTCTTTAAACATGGACAGAAAGGAGGACACTTTGTTGCCTGAGATCTCCCCAACTGCTTCTCCTCAGCCCTTTCTCCCTCTTT
TGGCACCTTCTCCGTGGGCACCTTTTACAAACAGCACTTTACCAAAATTATCGGGTCTGGTTCAGTATTTAATTAAAATGATAATCTCTTAGGTCTGAGC
AAGAACAAAATTTTAAAAGTTGGGGCTACTTCAAATTTTAGAGCAATTTAGAGTTGATAAACTAAATACAGCTCAGATAGATCTTGATTTGCTGTCACCT
CAGTCAGTGACTCTTCCTTTCATACTCCTTCAGGACTCTTGTACGCCTGAATTTTGATGC
>LE_HBa0057O20_SP6_45638 (trimmed for quality and cloning vector)
ATAATGTGGCTAAAGCAAATATAGAATGGTTTGATGGGCTAAATTTTGACAGTGAAATGTGAGGTAGTTTCTGTTGCAGACAGTATGATTTAACCAGCTC
AGTGAGACAATGTGAAGCATGAAATTCTGGAAATACTGGTTTCTCTAGGTATACAACTTTTCTGAATCTTCAAGATTTCATTAGACATTGAGGATGTCAA
GTTACATCATCACTACTGTTCTATTTGGGTGACTATATTATCTGAGACTAGTGGTTTCTTGTTGCCACTTAACTTGTTTTCCATTTAGTGCATGGGAGCA
CAAGCCCCAGTGGTGCTTGTAGCTTTGATCCATGTGTAACTGTATATATGCCTTCACTGGATGTAAGTGTTTTTAGTTGGTCATCTCCTAAAAGGAATCA
ATGCTGTTTCTTATTTCTGACGGAATTTCTGATTGTCCAGACCTCCAGGACTCCAGTTGCGGTTCAGTGAATTCTCTCAAGGGTTCTTTAAACATGGACA
GAAAGGAGGACACTTTGTTGCCTGAGATCTCCCCAACTGCTTCTCCTCAGCCCTTTCTCCCTCTTTTGGCACCTTCTCCGTGGGCACCTTTTACAAACAG
CACTTTACCAAAATTATCGGGTCTGGTTCAGTATTTAATTAAAATGATAATCTCTTAGGTCTGAGCAAGAACAAAATTTTAAAAGTTGGGGCTACTTCAA
ATTTTAGAGCAATTTAGAGTTGATAAACTAAATACAGCTCAGATAGATCTTGATTTGCTGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.960547
Expected error %
0.125774
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g61900.2 Score 66 E Value 2e-11 Identity 21.30% Align. Length 140bp (18.40%) Frame 3
68414.m06984 expressed protein contains similarity to glutamic acid/alanine-rich protein GI:6707830 from [Trypanosoma congolense]
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g61900.1 Score 66 E Value 2e-11 Identity 21.30% Align. Length 140bp (18.40%) Frame 3
68414.m06983 expressed protein contains similarity to glutamic acid/alanine-rich protein GI:6707830 from [Trypanosoma congolense]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057O20
Clone
Clone name
hba-57o20
LE_HBa0057O20
P057O20
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found