Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

Clone Read LE_HBa0057P09_T7_45665

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057P09_T7_45665
Primer
T7
ID from Seq. Facility
LE_HBa_057_P09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
781 trimmed for vector and quality, 861 raw
Sequence
>LE_HBa0057P09_T7_45665 (raw untrimmed)
TGGGTCCCGCGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAAACAAGTACCTGATATAGCCGGAGTAAGAATTCCATCACCTATTACCGTGC
AAGTGCCTATAACTACAAGAATAAGAAGCGAGGTCTTCCTGAATGGATATGCCTCCAACCATCTTTTTGTTTTTGCAGCAAATGAGTGCTCATGGAATGT
GCTGCGACTATAAGTTGTAAGCTCTTCATCTGTCCGGTGTTGGTTGGGAATTGTCTTTATCTTAGCATGGCGACATAACAAAGAATAAAGAGCAAAAGTC
CCACCTGAAAAGACAAAACCCAATTTTTATCATCTTTAACTTTTCATGCATTATTAGAGAACATATCTTTCATGTTGCTCTACAGTTGGGAGTTGATTTA
TGAAAAATATAAAGTACATGAGAAAAAAGGAAATTAAGTTAACTAAATACCAATATCAAATGAGTGCATGCAAATACAAAGTCCTTCTAACATTGTCAAC
ATTAGAGCAATTGGTTTATTGCAGTAAATAATTAACTTCAATTGATAGGCAAAATGATCTTTAAATTCAACATATAGTAACTGCATATCCAGGTGAAACT
AAGATATACTTAGCAAACAACTATATATCTTACAGTATTATCCAACAAGCTTTTCTCAAATTGCAATACAATCTAAAATTTTCATTCACCCTTTAATCAT
TTCGACATTCTCAACTTCTGCAACTTCTTTTATCCTTGCCGCGTTCACTTTTTTTCTTTTTCTTCTGAAACAGCGGAGAAGTCGAGATTTTCAGGGGCGA
GGAGAAGAAGTCTCTGTAAATGGAGATTTTTAGAAACAGACAATAACAAGGTCCAAATCTT
>LE_HBa0057P09_T7_45665 (trimmed for quality and cloning vector)
AGCTTCAAACAAGTACCTGATATAGCCGGAGTAAGAATTCCATCACCTATTACCGTGCAAGTGCCTATAACTACAAGAATAAGAAGCGAGGTCTTCCTGA
ATGGATATGCCTCCAACCATCTTTTTGTTTTTGCAGCAAATGAGTGCTCATGGAATGTGCTGCGACTATAAGTTGTAAGCTCTTCATCTGTCCGGTGTTG
GTTGGGAATTGTCTTTATCTTAGCATGGCGACATAACAAAGAATAAAGAGCAAAAGTCCCACCTGAAAAGACAAAACCCAATTTTTATCATCTTTAACTT
TTCATGCATTATTAGAGAACATATCTTTCATGTTGCTCTACAGTTGGGAGTTGATTTATGAAAAATATAAAGTACATGAGAAAAAAGGAAATTAAGTTAA
CTAAATACCAATATCAAATGAGTGCATGCAAATACAAAGTCCTTCTAACATTGTCAACATTAGAGCAATTGGTTTATTGCAGTAAATAATTAACTTCAAT
TGATAGGCAAAATGATCTTTAAATTCAACATATAGTAACTGCATATCCAGGTGAAACTAAGATATACTTAGCAAACAACTATATATCTTACAGTATTATC
CAACAAGCTTTTCTCAAATTGCAATACAATCTAAAATTTTCATTCACCCTTTAATCATTTCGACATTCTCAACTTCTGCAACTTCTTTTATCCTTGCCGC
GTTCACTTTTTTTCTTTTTCTTCTGAAACAGCGGAGAAGTCGAGATTTTCAGGGGCGAGGAGAAGAAGTCTCTGTAAATGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955179
Expected error %
0.362647
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g35060.1 Score 148 E Value 3e-36 Identity 28.90% Align. Length 245bp (31.37%) Frame 1
68415.m04301 potassium transporter family protein similar to HAK2 [Hordeum vulgare] GI:7108599, potassium transporter HAK2p [Mesembryanthemum crystallinum] gi|14091471|gb|AAK53759; KUP/HAK/KT Transporter family member, PMID:11500563; contains Pfam profile PF02705: K+ potassium transporter
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g31120.1 Score 144 E Value 7e-35 Identity 28.00% Align. Length 245bp (31.37%) Frame 1
68414.m03808 potassium transporter family protein similar to HAK2 [Hordeum vulgare] GI:7108599, potassium transporter [Arabidopsis thaliana] gi|2654088|gb|AAB87687; KUP/HAK/KT Transporter family member, PMID:11500563; contains Pfam profile PF02705: K+ potassium transporter
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM20451.1| Score 148 E Value 1e-34 Identity 28.90% Align. Length 245bp (31.37%) Frame 1
putative potassium transporter [Arabidopsis thaliana] gb|AAC12845.1| putative potassium transporter [Arabidopsis thaliana] sp|O64769|POT11_ARATH Potassium transporter 11 (AtPOT11) gb|AAN72158.1| putative potassium transporter [Arabidopsis thaliana] ref|NP_181051.1| potassium transporter family protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
sp|Q9SA05|POT10_ARATH Score 144 E Value 3e-33 Identity 28.00% Align. Length 245bp (31.37%) Frame 1
Putative potassium transporter 10 (AtPOT10) gb|AAD21693.1| Strong similarity to gi|3033401 F19I3.29 putative potassium transporter from Arabidopsis thaliana BAC gb|AC004238
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057P09
Clone
Clone name
hba-57p9
LE_HBa0057P09
C02HBa0057P09
P057P09
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found