Clone Read LE_HBa0058I03_T7_46085

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0058I03_T7_46085
Primer
T7
ID from Seq. Facility
LE_HBa_058_I03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
743 trimmed for vector and quality, 856 raw
Sequence
>LE_HBa0058I03_T7_46085 (raw untrimmed)
CTGGGAACCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAGGTTAACATCGAACAGGTTATTTTAGGTGTCACAATTTTTCAATTGAACG
TGCACTAATTTACCTTGTCAGCCAGCATCTGGTGCAGAACTCGAACAGCCTGTGCTCCAGCTGAATGTCCCACAAAATGAATAGGGTGATCTTCATCCCA
CTCGGGATAGTGCCCTGCTTCATTTTTTGTTAAGTGAAGCATTGATCCAGAAAAATAGAAATGTGATAGTCCTTTAATGGCTTAGTTTGACTGGCACAAT
GTTAAAGAAAGAACGATTTTTGAAACATGCGATCTTAAACATGTTATAACACGTGTGTGTCTATAAGCACTTGTCTTTCATTAGTATATAAGTGAAAGTT
CAAGTCAAACTGTTTCAAAATATACAAATGTGTAGTCATTTTCTTAACGGGACTTAACAGGAAATAATACCATTGGGAGTGAGTTATATATATGAAGTAA
AAATTTAACCTTGTTCATAAACTCGTCCAAATTGGGCATGTCCACAAGCCTTGCTGTGTTCCTCCCCATAATCAACTTGCCCACCTTTCAAATAATAGAA
CAATTCACGAGCCCTGAAATCTAAAATCCATCAATTGTTGCAAAAAGTATAGAACAAGAAGAACAGTATAACTATGACATATGTGACAATCTCATCAAAA
AGTTTAAGCTATTACGGAAAGCACACTTTTATTTATTTAACTATGTTTTCGAAATACCCCTCACATACGAGAGCTTGTAGTTCAAACAACTATTAAGAGT
TCCTAGAGCTCCCCCAAGGCTAGTATTGAAAGATCACACAGTTGAAATATGGTATT
>LE_HBa0058I03_T7_46085 (trimmed for quality and cloning vector)
AGCTTGAGGTTAACATCGAACAGGTTATTTTAGGTGTCACAATTTTTCAATTGAACGTGCACTAATTTACCTTGTCAGCCAGCATCTGGTGCAGAACTCG
AACAGCCTGTGCTCCAGCTGAATGTCCCACAAAATGAATAGGGTGATCTTCATCCCACTCGGGATAGTGCCCTGCTTCATTTTTTGTTAAGTGAAGCATT
GATCCAGAAAAATAGAAATGTGATAGTCCTTTAATGGCTTAGTTTGACTGGCACAATGTTAAAGAAAGAACGATTTTTGAAACATGCGATCTTAAACATG
TTATAACACGTGTGTGTCTATAAGCACTTGTCTTTCATTAGTATATAAGTGAAAGTTCAAGTCAAACTGTTTCAAAATATACAAATGTGTAGTCATTTTC
TTAACGGGACTTAACAGGAAATAATACCATTGGGAGTGAGTTATATATATGAAGTAAAAATTTAACCTTGTTCATAAACTCGTCCAAATTGGGCATGTCC
ACAAGCCTTGCTGTGTTCCTCCCCATAATCAACTTGCCCACCTTTCAAATAATAGAACAATTCACGAGCCCTGAAATCTAAAATCCATCAATTGTTGCAA
AAAGTATAGAACAAGAAGAACAGTATAACTATGACATATGTGACAATCTCATCAAAAAGTTTAAGCTATTACGGAAAGCACACTTTTATTTATTTAACTA
TGTTTTCGAAATACCCCTCACATACGAGAGCTTGTAGTTCAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.960084
Expected error %
0.337755
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g23330.1 Score 74 E Value 8e-14 Identity 83.80% Align. Length 504bp (67.83%) Frame 3
68414.m02917 expressed protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g10740.2 Score 71 E Value 6e-13 Identity 86.10% Align. Length 501bp (67.43%) Frame 3
68414.m01226 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_173747.1| Score 74 E Value 4e-12 Identity 83.80% Align. Length 504bp (67.83%) Frame 3
expressed protein [Arabidopsis thaliana] pir||D86367 protein F26F24.20 [imported] - Arabidopsis thaliana gb|AAF87012.1| F26F24.20 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAK27239.1| Score 71 E Value 3e-11 Identity 86.10% Align. Length 501bp (67.43%) Frame 3
putative lipase [Arabidopsis thaliana] gb|AAP31958.1| At1g10740 [Arabidopsis thaliana] gb|AAM53307.1| putative lipase [Arabidopsis thaliana] ref|NP_172544.1| expressed protein [Arabidopsis thaliana] pir||H86240 hypothetical protein [imported] - Arabidopsis thaliana gb|AAD31339.1| Similar to gb|X02844 lipase precursor from Staphylococcus hyicus. ESTs gb|AI239406 and gb|T76725 come from this gene. [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0058I03
Clone
Clone name
hba-58i3
LE_HBa0058I03
C01HBa0058I03
P058I03
Clone type
BAC
Contamination
none
Estimated length
130,633
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found