Clone Read LE_HBa0059C22_SP6_46602

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0059C22_SP6_46602
Primer
SP6
ID from Seq. Facility
LE_HBa_059_C22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
3 trimmed for vector and quality, 1402 raw
Sequence
>LE_HBa0059C22_SP6_46602 (raw untrimmed)
TCGTACCCACCGCCTTAGCTCTCACACCTACCTAACGTCCTCCANCACNNNNCNNNNCNNNCCCNNNCCCCTTCCCCCCCCCCCCACAANNCCACNCNNA
CCNNNNNACCCCCNNCNNCCNNCACCACACACAAAACCAACCCCACGGCTCCTCCTAACCAAGTCGGCGGCGCAAACGCCCAANACAGNNACAAAACANA
CACCACCAGCAAACCCGNACACCCCCTTTTTTGCGCAGGGACGAGCGCAACACGACCGCAACCTANCAGGCAACGATCTACACCGGACACAGTACTCATA
ACCCTGCACTACTACACATCACTACCANTGAAAGTCTCTCCAGCAGTATAATGGCACTATATCATCACTCTACTATACATAAGCCACATATGTCACTACA
CAGCAAATACTAACTCATGAAGCATCAACTCGTTTACTACAATATATCAACCAATACGATCCAAGAACTCACAACATCACAGCACGCCACAACTAGCAGA
CATCGCTGCAGTCACACACAGCCTACAACTTCCTAACGATACCATATGATCTACNACTCACACGTACACTAACTCGTCTCTACTAGCTCCGACCCTCAAT
CATGAATCATCCACAACAAAGCGAGTATCTCACTCACTCCAGTTCCATCTCCTCATATTCTGCAGGTCCATAACTCGAAAGATAACACCCTCAAGTCTCA
CGAATACAACAATCCTCAACGATAGGATGTCACTACAAACCCTCCAACTCAGCCTCCACCGCCAACAATCACTAACAATTCATCTTGATACTACCAATAA
TAAAAACCAACCATCAAATCAGATTCTACGACTCAACTACACAACCCCACTACGCTCATGCCTTCTAACACACAGATACATCACGATAGTGTATAGTCAA
TATCTCCTCCTCTATACTCTCTATCCTCAGCACTCACTTCTAAAGCCTCTTCGATAGTATTACCATCAGTTATTCATAGTAATAACTGTTCATCACCTCA
TGCCTACACTTTAAATAACTTTTCCTCTTTGACGCCTACA
AAAAAATAAATAAATCAGCATCAAATCAACTAACTATACTCCAATACTCTGACAACTCCC
TACCATTCACATCTCATCTAACCTCCATCCAAATTCATCGACGCGTGCAATGTGATCGCTATAACATCTATCTCCATCTTCCCTAGAACCTACTCTACTG
AATCAACACACTTACAACACCATACTTGACTCAAACTAAGTGAACACACTCGCTCCCTCACCACTTCATGGCTCATCTACTTAACATATTATCTACCAAA
CAATCCAATTCTCTCCATCCGTCATATACAAAATTGCAACATTATCAACACCAGCCGCGGATCACCTCCAGATACCACAATTACAACATGTATAAATCAT
AC
>LE_HBa0059C22_SP6_46602 (trimmed for quality and cloning vector)
AAA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Short cloning insert
  • Low complexity
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
not recorded
Expected error %
3.61914
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0059C22
Clone
Clone name
hba-59c22
LE_HBa0059C22
P059C22
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found