Clone Read LE_HBa0059C22_T7_46603

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0059C22_T7_46603
Primer
T7
ID from Seq. Facility
LE_HBa_059_C22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
625 trimmed for vector and quality, 916 raw
Sequence
>LE_HBa0059C22_T7_46603 (raw untrimmed)
TGGGCCGGGACCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGCAAGTGAGCTAGACTTCCCATGCTTCCCGCCTTCCTACTTAAAGCATC
CGCTACAACATTCGCCTTCCCCGGATGATACAAAATAGTGATGTCGTAGTCCTTCAGTAGTTTCATCCATCTCCTCTGTCTCAAGTTCAAATCTTTCTGA
GTGAAGACATACTGAAGGCTACGATGATCCGTGTAGACCTCACACTTAACCCCATATAAATAGTGTCTCCATTGCTTTAATGCAAACACTACCGCGGCCA
ATTCCAAATCATGAGTTGGATAGTTAGTTCATGCACTTTTAATTGTCTTGAAGCATAAGCAATCACATTCTTCTCTTGCATTAGCACTGTATCCAAACCC
GAATAGGATGCATCACAATAGACAATGAAGTTCTTACCTTCCACGGGCAAGGTGAGAATTGGTGCAGTAGTCAACAGAGTCTTGAGCTTCTGAAAGCTTT
CCTCACACTCATCCGACCATACGAATGGGACATTTTGCTTAGTCAAGTTCGTCAGTTGGGAAGCAATAGAAGAGAATCCCTTGACAAATCGGCGGTAGTA
GCTAGCTAACCCAACAAAGCTCCTTATTTCTGACACATTAGTAAGACCTACCCAATTCTTCACTGTCTCAATCTTAAAAGGATCCACCATACTCCATTCC
TTTAAAACCACATGCCCTAGAAGGGCACCATCTCAACCTCAAATCCCTCTTTGAAAACTCGGAATATAGCTTTTCTCGCTAGACCTTTCCACACCCTTCT
GAAAGCTCCTTCAGGTCCCCTTTGTCTTTTATCACTCCACCATCACTATAATATTTTTATATAAATTATGCCGCAAAGCGCTTTACATACTTTTCTTAAT
CATTTTGAAATGAGTG
>LE_HBa0059C22_T7_46603 (trimmed for quality and cloning vector)
AGCTTGCAAGTGAGCTAGACTTCCCATGCTTCCCGCCTTCCTACTTAAAGCATCCGCTACAACATTCGCCTTCCCCGGATGATACAAAATAGTGATGTCG
TAGTCCTTCAGTAGTTTCATCCATCTCCTCTGTCTCAAGTTCAAATCTTTCTGAGTGAAGACATACTGAAGGCTACGATGATCCGTGTAGACCTCACACT
TAACCCCATATAAATAGTGTCTCCATTGCTTTAATGCAAACACTACCGCGGCCAATTCCAAATCATGAGTTGGATAGTTAGTTCATGCACTTTTAATTGT
CTTGAAGCATAAGCAATCACATTCTTCTCTTGCATTAGCACTGTATCCAAACCCGAATAGGATGCATCACAATAGACAATGAAGTTCTTACCTTCCACGG
GCAAGGTGAGAATTGGTGCAGTAGTCAACAGAGTCTTGAGCTTCTGAAAGCTTTCCTCACACTCATCCGACCATACGAATGGGACATTTTGCTTAGTCAA
GTTCGTCAGTTGGGAAGCAATAGAAGAGAATCCCTTGACAAATCGGCGGTAGTAGCTAGCTAACCCAACAAAGCTCCTTATTTCTGACACATTAGTAAGA
CCTACCCAATTCTTCACTGTCTCAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978711
Expected error %
0.766967
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 166 E Value 3e-73 Identity 57.90% Align. Length 616bp (98.56%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 166 E Value 2e-74 Identity 60.50% Align. Length 616bp (98.56%) Frame 2
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0059C22
Clone
Clone name
hba-59c22
LE_HBa0059C22
P059C22
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found