Clone Read LE_HBa0059I05_SP6_46856

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0059I05_SP6_46856
Primer
SP6
ID from Seq. Facility
LE_HBa_059_I05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
657 trimmed for vector and quality, 847 raw
Sequence
>LE_HBa0059I05_SP6_46856 (raw untrimmed)
TAATGGTTGCTGTCCTAGTACTTACGTACTCTTGACTTACAATGTGTTGAATTCCTAAACATATATTAGTTTTGATTTTTGTAACAGATGATGGGTAAAG
TTAATAAAGAGAGGTTGGCTGAGTACCTTGGCGAACTGCAGAGAAAGGAGAACACAAATGACAGATATGTTGCAGCTCTAAAGGGCGAAACGTTGACAAG
GAAACCTTACCAAAGAATTCAACCAGTCCCAAATCCAAGTGATATTGAAGCAAAGAAGGAACAGAAGTAGATCGTGGCTTAACCGGTTTTGTTGATTTAG
TTTGGTACTTCTACTTTTTCCAATGGATAAAGCTTTGGAATGGAATCATGGACACAACTGGAGTTATTGCTATATATCTTTGAAACTTGTACAAGTAAAA
TTTGAAGAACGACTGTTGTCGAATGAGTGAAATCTCATTGAAGTTAAAATAACCACATCTTAGTTCTAGCGCGAGTAATCTTGTTTACTTGCATTGCGAT
ATTGTGTTATGCGTGCAAGGATTTGTTGTACTTGATTACTATATAGTATGAAAGTGCACGATTTAAGTGAATATTTTCTTATGTAAACCAAAATTTTGAA
ATTCAGCTCCTCCTTTCGTTCTGTTCCCTAGTTTCGCCAGACAAAGGTCAATATTTATGTTGGCACATGATACATTCAGTTGCATTAAAATATAACTCAT
TCAGTATACAAACAAGTTCTCCAGATTTAACTTTCAAATATCCCAAACAATACCGAAAACTGTGGTTCTTTAATACTTTATTCCTCTGACCCAATTTTAA
AAGAAAAAAAAAAAGAACCCAATTTGTACCCATTTTCCCATGATTGA
>LE_HBa0059I05_SP6_46856 (trimmed for quality and cloning vector)
TGACTTACAATGTGTTGAATTCCTAAACATATATTAGTTTTGATTTTTGTAACAGATGATGGGTAAAGTTAATAAAGAGAGGTTGGCTGAGTACCTTGGC
GAACTGCAGAGAAAGGAGAACACAAATGACAGATATGTTGCAGCTCTAAAGGGCGAAACGTTGACAAGGAAACCTTACCAAAGAATTCAACCAGTCCCAA
ATCCAAGTGATATTGAAGCAAAGAAGGAACAGAAGTAGATCGTGGCTTAACCGGTTTTGTTGATTTAGTTTGGTACTTCTACTTTTTCCAATGGATAAAG
CTTTGGAATGGAATCATGGACACAACTGGAGTTATTGCTATATATCTTTGAAACTTGTACAAGTAAAATTTGAAGAACGACTGTTGTCGAATGAGTGAAA
TCTCATTGAAGTTAAAATAACCACATCTTAGTTCTAGCGCGAGTAATCTTGTTTACTTGCATTGCGATATTGTGTTATGCGTGCAAGGATTTGTTGTACT
TGATTACTATATAGTATGAAAGTGCACGATTTAAGTGAATATTTTCTTATGTAAACCAAAATTTTGAAATTCAGCTCCTCCTTTCGTTCTGTTCCCTAGT
TTCGCCAGACAAAGGTCAATATTTATGTTGGCACATGATACATTCAGTTGCATTAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952222
Expected error %
0.236601
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g79390.1 Score 97 E Value 1e-20 Identity 25.40% Align. Length 176bp (26.79%) Frame 3
68414.m09252 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAK00392.1| Score 97 E Value 4e-19 Identity 25.40% Align. Length 176bp (26.79%) Frame 3
unknown protein [Arabidopsis thaliana] gb|AAG41475.1| unknown protein [Arabidopsis thaliana] ref|NP_565207.1| expressed protein [Arabidopsis thaliana] gb|AAG40025.1| At1g79390 [Arabidopsis thaliana] gb|AAD30237.1| EST gb|F19962 comes from this gene. [Arabidopsis thaliana] pir||H96824 hypothetical protein T8K14.19 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_465798.1| Score 86 E Value 6e-16 Identity 29.10% Align. Length 140bp (21.31%) Frame 3
unknown protein [Oryza sativa (japonica cultivar-group)] dbj|BAD23141.1| unknown protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0059I05
Clone
Clone name
hba-59i5
LE_HBa0059I05
C09HBa0059I05
P059I05
Clone type
BAC
Contamination
none
Estimated length
95,676
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found