Clone Read LE_HBa0059L06_SP6_47002

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0059L06_SP6_47002
Primer
SP6
ID from Seq. Facility
LE_HBa_059_L06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
679 trimmed for vector and quality, 830 raw
Sequence
>LE_HBa0059L06_SP6_47002 (raw untrimmed)
TTTTTATTACATAAGTNGGGTAAAAGATNGAGACTTAAATGTCCATTTTGTCTAGACTATTACATTTTAAGTATTTCTCTTGAGAATGTTCTTTATTATT
ATAATTGAGTTAAGTTAAGTCTTCATCGGATTTAAGTTATCCAGGCCAAGGGTTTGTTCAAGACCATCAATGGTCATTAGGTGTCGCTCACATCCAGGGT
GTAGGCTCGAGGCGTAACACTTTCCTAGTTGATCACTCCGGAATGAGTAATGGTTAATTGATATCTATTATAATGACCTGATTTGGTCGTTTGGAAAAAT
CCAAAGGATAAGGAATTGGGGTCAGAAAATTTTTGGTAGTAACTTGAAATTTCTTAATCTAGTCCAGATTTGAATGAAATTAAAATCATTAAAGTCTAAG
GAAATCTAGTAAGAACTACTGATTTAATTATGATTTTGATTTCATGAATAGATATTTATGACGTTAAGGAACCGATATGACTTTACGGAATAAAATTCAG
GCGAGTAGAACTCCCAAAAATGATCTTAGCGTGAGAGTGTGATTTTTGATATCAAAGGTTGAAGGAGTTTTGTGAATTGGGGGCTTGAAATTCAAATTTA
AAAATTATGTCTTTATTCATGAATTTGTAGCGGGGTGGTTGTCCCTGTAGTGGGATGGGTCTTGCTGTAGCGGGACAGACGCGACTTTAGTTGGAAACAA
AACCCCAAAAATATTTTACTTTGCACTTTTTGAATTTGAGAGCTAAGGAAACAACCCTATGAGTTTACTTGAATTGTTTTCCACCCTTATTGAGGCCAAA
ATGTAAAATTTCACTCCCCCACATCTGTTT
>LE_HBa0059L06_SP6_47002 (trimmed for quality and cloning vector)
GACTTAAATGTCCATTTTGTCTAGACTATTACATTTTAAGTATTTCTCTTGAGAATGTTCTTTATTATTATAATTGAGTTAAGTTAAGTCTTCATCGGAT
TTAAGTTATCCAGGCCAAGGGTTTGTTCAAGACCATCAATGGTCATTAGGTGTCGCTCACATCCAGGGTGTAGGCTCGAGGCGTAACACTTTCCTAGTTG
ATCACTCCGGAATGAGTAATGGTTAATTGATATCTATTATAATGACCTGATTTGGTCGTTTGGAAAAATCCAAAGGATAAGGAATTGGGGTCAGAAAATT
TTTGGTAGTAACTTGAAATTTCTTAATCTAGTCCAGATTTGAATGAAATTAAAATCATTAAAGTCTAAGGAAATCTAGTAAGAACTACTGATTTAATTAT
GATTTTGATTTCATGAATAGATATTTATGACGTTAAGGAACCGATATGACTTTACGGAATAAAATTCAGGCGAGTAGAACTCCCAAAAATGATCTTAGCG
TGAGAGTGTGATTTTTGATATCAAAGGTTGAAGGAGTTTTGTGAATTGGGGGCTTGAAATTCAAATTTAAAAATTATGTCTTTATTCATGAATTTGTAGC
GGGGTGGTTGTCCCTGTAGTGGGATGGGTCTTGCTGTAGCGGGACAGACGCGACTTTAGTTGGAAACAAAACCCCAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944896
Expected error %
0.19417
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0059L06
Clone
Clone name
hba-59l6
LE_HBa0059L06
P059L06
Clone type
BAC
Contamination
none
Estimated length
116,930
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found