Clone Read LE_HBa0059N06_SP6_47098

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0059N06_SP6_47098
Primer
SP6
ID from Seq. Facility
LE_HBa_059_N06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
604 trimmed for vector and quality, 823 raw
Sequence
>LE_HBa0059N06_SP6_47098 (raw untrimmed)
AAAAAGGGGATGTGCGACGATCTCTTACAATTCATCATAAAACTTTAATAGGTAGTATGTTGNAANAGATGGANAGTNTGTTGCCATAAATTAACAATAT
GTTGCCACATATGTACCTACTGTTGCAACACATAAACTTTCTATTGCAACATATAGACCTTATTTTGCAACATATGAATCTTATGTGACAACAGATGACC
ATTTTGTTGACCTAAAGTGAGATGTTACAACATATTATAAAAGTTTAAATATGCACCAACATATCACTAAAATGTGGCAACATACACTAAATATTTCAAC
AAATGAAATATATGTTGGACACCTGAACAAAATTATATTTCTAAAATCTTATCATCAAAATGGCCACAAATAGAACAACAACAGCAACAGAAAATGACTT
TTCACTGAATGATAACAATACATATACATTTCCTCGAAATGAAGATTTTTTGGGTTGGTTGAATATCTTTCAAAAATAATAAATAATACACACCTTTAAG
TCGATTATTCAATTTTTACATCTACTAAACATTTTATTGTTCATTAATTCAAGAAAAAAACTTCAAAAATTATAAAATATTTTTAAAAAATAATTTACCC
ATTTCTAGTCGAATAGGATTACAGATGAGAGAGTAACGGCTGGAGAGTAAGATAATGGAGGACTGTAGAGGAAGAGTATAACGTCTGAAGAAAAGAGTAA
TGAGATACGAATTTCCGAATTTCTAAGGAAAAAGAAGAACAATCCCCCAAGAGACGAAGAAGAAAGAGAAGAGAGGAAGAAGATGAAAAGAATTTTTAAA
TAAAAATGAATTGGTTTTGAATT
>LE_HBa0059N06_SP6_47098 (trimmed for quality and cloning vector)
TAAATTAACAATATGTTGCCACATATGTACCTACTGTTGCAACACATAAACTTTCTATTGCAACATATAGACCTTATTTTGCAACATATGAATCTTATGT
GACAACAGATGACCATTTTGTTGACCTAAAGTGAGATGTTACAACATATTATAAAAGTTTAAATATGCACCAACATATCACTAAAATGTGGCAACATACA
CTAAATATTTCAACAAATGAAATATATGTTGGACACCTGAACAAAATTATATTTCTAAAATCTTATCATCAAAATGGCCACAAATAGAACAACAACAGCA
ACAGAAAATGACTTTTCACTGAATGATAACAATACATATACATTTCCTCGAAATGAAGATTTTTTGGGTTGGTTGAATATCTTTCAAAAATAATAAATAA
TACACACCTTTAAGTCGATTATTCAATTTTTACATCTACTAAACATTTTATTGTTCATTAATTCAAGAAAAAAACTTCAAAAATTATAAAATATTTTTAA
AAAATAATTTACCCATTTCTAGTCGAATAGGATTACAGATGAGAGAGTAACGGCTGGAGAGTAAGATAATGGAGGACTGTAGAGGAAGAGTATAACGTCT
GAAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.912917
Expected error %
0.0430804
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0059N06
Clone
Clone name
hba-59n6
LE_HBa0059N06
C02HBa0059N06
P059N06
Clone type
BAC
Contamination
none
Estimated length
129,466
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found