Clone Read LE_HBa0059N06_T7_47099

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0059N06_T7_47099
Primer
T7
ID from Seq. Facility
LE_HBa_059_N06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
829 trimmed for vector and quality, 940 raw
Sequence
>LE_HBa0059N06_T7_47099 (raw untrimmed)
ACCAACTGGGACCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGCAAGGATGAGGATTCCGAAAAAGTGGATGATAGTATGTATAGAAGC
TTAATTGGTAGTCTTCTATATCTAACCGCAAGCAGGCCTGACATTCTATTTGTTGTTAGTTTGCTCTCTAGGTTCATGCATTCGCTTAGAGACACACACC
TCACAACTGCTAAAAGAGTGTTAAGGTATATTAAAGAAACTAGCAAGTTTGGAATTTTTTTCCCAACATCTGCCGAAGTAACTATGAACCTGATTGGGTA
CTCTGATAGTGATTGGGGTGGTGGAGGTGATGATTCCAGAAGCACATCTGGATATCTTTTCTGTTTGGGGACAAGTTGTTTTAGTTAGAGCTCTAGAAAA
CAAGAAACTACAGCTCAATCAACAACAGAAGCTGAGTACATAGTTGTTGCATCTGCTGTGAATCAAGTTATCTGGCTAAGGAAGATGATGAAGGACTTAG
GCCATGAACAAACAGAAGCTACCAAGATCATGTGTGACAACATTTCAACAGTTTCAATCTCAAAAAATCCAGTGTTCTATGGTCGAACTAAACATATCAA
GATCAAGTTTCATTTTATCAGGGAAGTCCAACAATCTAATGAAGTGTTGCTTGTTCATTGTTCATCTGAGAACCAGCTAGCTGACATTTTCAATAAGTCA
TTGCCAAAGGAAAGGTTTGAAGATCTGAGACAAAGAAATTGGTGTTTGCCACAAAAATGCCAAGGCGGAGTGTTAGACAATTGACATTTTTTCAGCTTAT
TATTATTTTTACTGGTTTTTACTTATTTCAATTTAGTGCTTCCTATTTTCTAGCTAGACTTAGTCAACTTTAGTTGCTCAACTTTCTAATGTTAGTGCCC
CATTATGGCTGTTAGTGGCCTCCTTATGGAAGTTAGTGGA
>LE_HBa0059N06_T7_47099 (trimmed for quality and cloning vector)
AGCTTGGCAAGGATGAGGATTCCGAAAAAGTGGATGATAGTATGTATAGAAGCTTAATTGGTAGTCTTCTATATCTAACCGCAAGCAGGCCTGACATTCT
ATTTGTTGTTAGTTTGCTCTCTAGGTTCATGCATTCGCTTAGAGACACACACCTCACAACTGCTAAAAGAGTGTTAAGGTATATTAAAGAAACTAGCAAG
TTTGGAATTTTTTTCCCAACATCTGCCGAAGTAACTATGAACCTGATTGGGTACTCTGATAGTGATTGGGGTGGTGGAGGTGATGATTCCAGAAGCACAT
CTGGATATCTTTTCTGTTTGGGGACAAGTTGTTTTAGTTAGAGCTCTAGAAAACAAGAAACTACAGCTCAATCAACAACAGAAGCTGAGTACATAGTTGT
TGCATCTGCTGTGAATCAAGTTATCTGGCTAAGGAAGATGATGAAGGACTTAGGCCATGAACAAACAGAAGCTACCAAGATCATGTGTGACAACATTTCA
ACAGTTTCAATCTCAAAAAATCCAGTGTTCTATGGTCGAACTAAACATATCAAGATCAAGTTTCATTTTATCAGGGAAGTCCAACAATCTAATGAAGTGT
TGCTTGTTCATTGTTCATCTGAGAACCAGCTAGCTGACATTTTCAATAAGTCATTGCCAAAGGAAAGGTTTGAAGATCTGAGACAAAGAAATTGGTGTTT
GCCACAAAAATGCCAAGGCGGAGTGTTAGACAATTGACATTTTTTCAGCTTATTATTATTTTTACTGGTTTTTACTTATTTCAATTTAGTGCTTCCTATT
TTCTAGCTAGACTTAGTCAACTTTAGTTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.962008
Expected error %
0.727499
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 102 E Value 3e-22 Identity 10.90% Align. Length 548bp (66.10%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38797.1| Score 338 E Value 1e-93 Identity 77.30% Align. Length 723bp (87.21%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38786.1| Score 210 E Value 4e-53 Identity 15.30% Align. Length 686bp (82.75%) Frame 1
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0059N06
Clone
Clone name
hba-59n6
LE_HBa0059N06
C02HBa0059N06
P059N06
Clone type
BAC
Contamination
none
Estimated length
129,466
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found