Clone Read LE_HBa0061F07_SP6_47484

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0061F07_SP6_47484
Primer
SP6
ID from Seq. Facility
LE_HBa_061_F07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
804 trimmed for vector and quality, 917 raw
Sequence
>LE_HBa0061F07_SP6_47484 (raw untrimmed)
TTCCCTCGCTCTACTTTNCTCTATAGCCAAAAGATTAAGAAAANCTAACCTGAGCCACCAACATTGCCCTNTGGAGGAATCTTCATATAATGTCCAAGTT
TTAAGTCTTGCAGGAAGGTTAAACCTTGCTTCATACTGATATAGCCATACACCTTGAAGCACATATTAGCAACTGGATATCCTGGATACAAGTATCCCAT
TATGTACTCCGTGATCACATTCAAACCAGGTGTCTGAGCAACAAAGATCGTGGAACATCAGAGTTGCCAAATGAAGAAAGCAACTCACAACACTGACACC
AAGCTATAATTTTAACTAAATCCGATAGTGAGTATTTGGACAAAAACTGTAGCTATTGATGATCTCAAGCTGTTATTTTACTGAAAATTAAATATGTGCT
TACTTGATTTGTGGTAGCAGTAATGACTCCAATTGGGAGGGTGAAAAAGAACGCCAGGCCACATGCTAACAAAACACCCCACCATGGTAATTGAAGCTGG
TTTTTGTAATATTCACATACAAATACAGTTGCTATAATATTTATTAGTAGTATAATCGTGAACCACCATTCAGGAAGTTGCTTGTATTTTCTCATGAGCT
TCGTGTGCACGTCCATTTTCTTTTCCTGTAAAGCAGACTTGCTGAGATGCCATAGATCCCTGCACCACTATAACTAGTCAAGTGGTGCTTCCATTCTATA
CATCAAGGCAGGGGTTACATTCACTAATGGTTACTAAACATTATGCACTAAACTTTTCTAGTCTGAAAACTATTGCCACATTAAAATACTGAATTTTATC
CCCTATAACAGTAAAGTATGAAGCTTACCATCCATGAAAGAGGAAGACATGAACAACCGTGGCAGTGAGGCAGGCAAAGCTGAATCCATAAGTTAGTAAA
AGGACAATGCTGAGATA
>LE_HBa0061F07_SP6_47484 (trimmed for quality and cloning vector)
AAAAGATTAAGAAAANCTAACCTGAGCCACCAACATTGCCCTNTGGAGGAATCTTCATATAATGTCCAAGTTTTAAGTCTTGCAGGAAGGTTAAACCTTG
CTTCATACTGATATAGCCATACACCTTGAAGCACATATTAGCAACTGGATATCCTGGATACAAGTATCCCATTATGTACTCCGTGATCACATTCAAACCA
GGTGTCTGAGCAACAAAGATCGTGGAACATCAGAGTTGCCAAATGAAGAAAGCAACTCACAACACTGACACCAAGCTATAATTTTAACTAAATCCGATAG
TGAGTATTTGGACAAAAACTGTAGCTATTGATGATCTCAAGCTGTTATTTTACTGAAAATTAAATATGTGCTTACTTGATTTGTGGTAGCAGTAATGACT
CCAATTGGGAGGGTGAAAAAGAACGCCAGGCCACATGCTAACAAAACACCCCACCATGGTAATTGAAGCTGGTTTTTGTAATATTCACATACAAATACAG
TTGCTATAATATTTATTAGTAGTATAATCGTGAACCACCATTCAGGAAGTTGCTTGTATTTTCTCATGAGCTTCGTGTGCACGTCCATTTTCTTTTCCTG
TAAAGCAGACTTGCTGAGATGCCATAGATCCCTGCACCACTATAACTAGTCAAGTGGTGCTTCCATTCTATACATCAAGGCAGGGGTTACATTCACTAAT
GGTTACTAAACATTATGCACTAAACTTTTCTAGTCTGAAAACTATTGCCACATTAAAATACTGAATTTTATCCCCTATAACAGTAAAGTATGAAGCTTAC
CATC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.97285
Expected error %
0.641687
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g10770.1 Score 134 E Value 6e-32 Identity 65.10% Align. Length 589bp (73.26%) Frame 3
68417.m01757 oligopeptide transporter OPT family protein similar to oligopeptide transporter Opt1p [Candida albicans] GI:2367386; contains Pfam profile PF03169: OPT oligopeptide transporter protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g53520.1 Score 109 E Value 2e-24 Identity 57.00% Align. Length 589bp (73.26%) Frame 3
68418.m06651 oligopeptide transporter OPT family protein similar to SP|P40900 Sexual differentiation process protein isp4 {Schizosaccharomyces pombe}, oligopeptide transporter Opt1p [Candida albicans] GI:2367386; contains Pfam profile PF03169: OPT oligopeptide transporter protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_910351.1| Score 150 E Value 3e-35 Identity 75.30% Align. Length 586bp (72.89%) Frame 3
EST D25093(R3139) corresponds to a region of the predicted gene.~Similar to Arabidopsis thaliana BAC T12H20; isp4-like protein (AF080119) [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_550563.1| Score 150 E Value 3e-35 Identity 75.30% Align. Length 586bp (72.89%) Frame 3
putative sexual differentiation process protein isp4 [Oryza sativa (japonica cultivar-group)] dbj|BAD67732.1| putative sexual differentiation process protein isp4 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0061F07
Clone
Clone name
hba-61f7
LE_HBa0061F07
C02HBa0061F07
P061F07
Clone type
BAC
Contamination
none
Estimated length
52,216
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found