Clone Read LE_HBa0061F07_T7_47485

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0061F07_T7_47485
Primer
T7
ID from Seq. Facility
LE_HBa_061_F07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
891 trimmed for vector and quality, 1000 raw
Sequence
>LE_HBa0061F07_T7_47485 (raw untrimmed)
CCAAACCGGGTTACCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACGAGCAAAAGGGGAAGAACACAATGACAGTTCTCCATTTTTGTT
TGAAAGGACGAAAGGATATTGTTCCTGCTGACTTGCAATTGGAAGTTGAGTAATAGTGATCAAGAAGAACTAAAATGTGTGTGCTCATGTCATGATGAAA
GAAATAATTGTCTTAAAAAACATAAATGCGACAGAGATTGCATAACCGAAGACCCTGACAAAATGAACAAGATCCTACATGCCTCAAGCAGTACAGCAAC
TGATAGTATATTTTTCCAGACAGCAAACTAGAAACATAGCGAACAATGCACTTCACAAATCTAAGGACCTCGGAAACTGTCTGCTTTGTCCAGTCTTGAG
ATACCTGAGCTTGAGGACTCTCCCATTACATCAGGAGAAGATGTTGGATGGTGTTCGCGCTTCAAAGAAGTAGGCAGTCCTGAAACTTCCTGAAAGAAAA
TTAGAAGGAGTAACATTTCTTTAGGCTAAATTTACACAATTTCATGATTAGGATAGAGAATGTCATGTTGCAATGTTTGCACTCGATAAGAATTCAGATG
ACTGATTTTCCACTCAACATTCAATAGCAAGCAATTATTTATACCATTATCTGAAGGAATCAAAATTTGAGAAAATCAACAACCCTGGCCAAATCAAAAC
CAGTTGCCACCGGAAATACAGGCCTTAGATATAGATTATTGCTATGATTCCTTCAGACAGAAATATCAGGTGCAGATGTAATATTTCCTCTTTATAATGC
AGTGACTTCACTATTTTAATCTTAAATGCAGGCATGTGTGCTCAGGTGAAGCACCACAGCNAATAAACCCTAAGAACTATTTCCTCTGAAGTATCTCATC
TTAGGGGTATAAGAGAAAAAGGTAAATGCTCAATTCATCGTACAGACCAATACGTGCTCACTTTCAAGATGGCACAGTAGCATTGCTGTTACTGTAGTCC
>LE_HBa0061F07_T7_47485 (trimmed for quality and cloning vector)
AGCTTAACGAGCAAAAGGGGAAGAACACAATGACAGTTCTCCATTTTTGTTTGAAAGGACGAAAGGATATTGTTCCTGCTGACTTGCAATTGGAAGTTGA
GTAATAGTGATCAAGAAGAACTAAAATGTGTGTGCTCATGTCATGATGAAAGAAATAATTGTCTTAAAAAACATAAATGCGACAGAGATTGCATAACCGA
AGACCCTGACAAAATGAACAAGATCCTACATGCCTCAAGCAGTACAGCAACTGATAGTATATTTTTCCAGACAGCAAACTAGAAACATAGCGAACAATGC
ACTTCACAAATCTAAGGACCTCGGAAACTGTCTGCTTTGTCCAGTCTTGAGATACCTGAGCTTGAGGACTCTCCCATTACATCAGGAGAAGATGTTGGAT
GGTGTTCGCGCTTCAAAGAAGTAGGCAGTCCTGAAACTTCCTGAAAGAAAATTAGAAGGAGTAACATTTCTTTAGGCTAAATTTACACAATTTCATGATT
AGGATAGAGAATGTCATGTTGCAATGTTTGCACTCGATAAGAATTCAGATGACTGATTTTCCACTCAACATTCAATAGCAAGCAATTATTTATACCATTA
TCTGAAGGAATCAAAATTTGAGAAAATCAACAACCCTGGCCAAATCAAAACCAGTTGCCACCGGAAATACAGGCCTTAGATATAGATTATTGCTATGATT
CCTTCAGACAGAAATATCAGGTGCAGATGTAATATTTCCTCTTTATAATGCAGTGACTTCACTATTTTAATCTTAAATGCAGGCATGTGTGCTCAGGTGA
AGCACCACAGCNAATAAACCCTAAGAACTATTTCCTCTGAAGTATCTCATCTTAGGGGTATAAGAGAAAAAGGTAAATGCTCAATTCATCG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.960529
Expected error %
1.02667
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0061F07
Clone
Clone name
hba-61f7
LE_HBa0061F07
C02HBa0061F07
P061F07
Clone type
BAC
Contamination
none
Estimated length
52,216
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found