Clone Read LE_HBa0010D01_SP6_4752

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0010D01_SP6_4752
Primer
SP6
ID from Seq. Facility
LE_HBa_010_D01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
592 trimmed for vector and quality, 935 raw
Genbank Accession
Sequence
>LE_HBa0010D01_SP6_4752 (raw untrimmed)
GGCATACTGATACTAGCAGACATATTTTTNGTATACGATTACATTTGTGTACTTTTCGTGTCCTTCTTCTTCGTTTCTGGTTCTTTGATTGTCGCTCGAT
CTGCAATTGTCTCTTACAGATTCTTCTTCTCTGTTTTCTGAATTTTCTTTTGGATCTATTCATCCATGGGGGATACCACTACAAGTTCTGGCCAATCTGG
AGGTCCTACTAGTAGTACAATTGATTCTAATCATCCCTACTATATACATCCATCTGATAACCCTGGAGCAATGCTGGTACCAGTTCAATTTACTGGAGTA
GGTTTTTGCTCATGGAGATGTAGTGTTATGAGAACACTTTCAGTGAAGAACAAGTTGGGATTTGTCAATGGAGATTGCTCACGTCCTCGATCAAGTGATC
CATCATACAGACAATGGGAGAGATGCGACAACATTGTCACTTCTTGGATTCTAAATTCACTGTCTAAGGAAATTGCTGATAGTGTTGAGTATGTTCAGGA
TTCTGCAGAATTGTGGAAGGAATTGGAGGATAGGTATGAGCAAACAAATGGTGCGAAGTTATACCAGATCCAACGAGAAATTAATGACTTGTCGCAGGGA
TCTCTTGACATTACAGGTTACTACACCAAGCTGAAAAAGTTATGGGAGGAGATAAATACCTTAAATGCCAAACCTCAATGCACTTGCAACTGCACTTGTG
GAGCAAAGGGAATTCTCACAAAGCAGACCAAGAAAGGAGGTTATCCAATTTCTCCTGGGATTGATGAAAGTACCCATTCTTCCTGGGAAGTTACTTATGA
TAATCCCCTGCTATAGGGTTCAGGCTTTTTTTCACTATTCAAAAATAAAACCAAAAGGAAATAAGCTTTGGTTTTTTATGCAAAATCATGCTTTATTTCG
GAATAATAGGGCTTTTCTATAACGGGAACTCAACT
>LE_HBa0010D01_SP6_4752 (trimmed for quality and cloning vector)
CCTTCTTCTTCGTTTCTGGTTCTTTGATTGTCGCTCGATCTGCAATTGTCTCTTACAGATTCTTCTTCTCTGTTTTCTGAATTTTCTTTTGGATCTATTC
ATCCATGGGGGATACCACTACAAGTTCTGGCCAATCTGGAGGTCCTACTAGTAGTACAATTGATTCTAATCATCCCTACTATATACATCCATCTGATAAC
CCTGGAGCAATGCTGGTACCAGTTCAATTTACTGGAGTAGGTTTTTGCTCATGGAGATGTAGTGTTATGAGAACACTTTCAGTGAAGAACAAGTTGGGAT
TTGTCAATGGAGATTGCTCACGTCCTCGATCAAGTGATCCATCATACAGACAATGGGAGAGATGCGACAACATTGTCACTTCTTGGATTCTAAATTCACT
GTCTAAGGAAATTGCTGATAGTGTTGAGTATGTTCAGGATTCTGCAGAATTGTGGAAGGAATTGGAGGATAGGTATGAGCAAACAAATGGTGCGAAGTTA
TACCAGATCCAACGAGAAATTAATGACTTGTCGCAGGGATCTCTTGACATTACAGGTTACTACACCAAGCTGAAAAAGTTATGGGAGGAGAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964414
Expected error %
0.14514
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g21280.1 Score 89 E Value 1e-18 Identity 10.00% Align. Length 428bp (72.30%) Frame 1
68414.m02659 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89730.1| Score 162 E Value 7e-39 Identity 16.70% Align. Length 431bp (72.80%) Frame 1
putative polyprotein [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA72989.1| Score 135 E Value 7e-31 Identity 13.30% Align. Length 413bp (69.76%) Frame 1
unnamed protein product [Brassica oleracea] pir||T14517 hypothetical protein 1 - wild cabbage transposon Melmoth
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0010D01
Clone
Clone name
hba-10d1
LE_HBa0010D01
C01HBa0010D01
P010D01
Clone type
BAC
Contamination
none
Estimated length
67,725
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found