Clone Read LE_HBa0010D01_T7_4753

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0010D01_T7_4753
Primer
T7
ID from Seq. Facility
LE_HBa_010_D01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
768 trimmed for vector and quality, 967 raw
Genbank Accession
Sequence
>LE_HBa0010D01_T7_4753 (raw untrimmed)
CAAAACTGGGTCCCGGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTTGCAGCAGCTTATGTTCCCCTTTCGTGGGCCACAATACTCTGTGC
TAGCTTTGGTTCTGGCACACATGCATTCACATTGGATCATACAACCGGAGATTTCCTCTTGACACATCCTAACATCAACATTCCTCCTCGAGGTATTGCT
ATATCATAAGTTTGTTCCTCCAAATACGTTTTTGCATATTACACCTTCTAAACTGATAGTTACATTGTTGACATTTTCTGGCAGGGCAAATTTATTCAGT
TAATGATGCTCGGTATTTTGACTGGCCTGAAGGATTAAGGCAGTATATTGATACGATAAGACAAGGGAAAGGACAACATCCTAAGAAGTACTCAGCCAGG
TATATATGTTCTCTAGTGGCTGATTTTCATCGGACTCTGTTATATGGTGGCGTAGCAATGAATCCAAGAAACCACCTTCGACTTGTTTATGAAGCAAATC
CTCTGAGTTTCTTAGCGGAAAAGGCTGGAGGTAGAGGTTCAGATGGTAAAAATAGAATTTTATCTATTCAACCTGTCAAGCTACACCAAAGACTTCCTCT
ATTTTTGGGAAGTTTGGAGGATATAGAAGAATTACAGAGTTATGGAGATGTTCAGCAGAAAGTGAACCCTGGTTATGATGTTTAATGCCCTTGTCCCTCT
TTCATGCAGTTTGCTCATCTCTCTTTGACATGTAAATTTTTTTGCTTGTTAGCTAGTAAATATGCTCTTCACTAGAATAAACATGTGATTTTCTATACCT
ACTCTTGAATATTGTCATATGATGTATCCTTAGACCACCTTAATTTACTGGTTAAATTAAAATTTAAATATTACTTAATTAATCCAACAATTATGAACAA
AAAATTTAATTCAATACAAGAAATCAATTATTCCTCTGTCCCTTTTTTTTGTCAATGCCTTTTTAAA
>LE_HBa0010D01_T7_4753 (trimmed for quality and cloning vector)
AGCTTGTTGCAGCAGCTTATGTTCCCCTTTCGTGGGCCACAATACTCTGTGCTAGCTTTGGTTCTGGCACACATGCATTCACATTGGATCATACAACCGG
AGATTTCCTCTTGACACATCCTAACATCAACATTCCTCCTCGAGGTATTGCTATATCATAAGTTTGTTCCTCCAAATACGTTTTTGCATATTACACCTTC
TAAACTGATAGTTACATTGTTGACATTTTCTGGCAGGGCAAATTTATTCAGTTAATGATGCTCGGTATTTTGACTGGCCTGAAGGATTAAGGCAGTATAT
TGATACGATAAGACAAGGGAAAGGACAACATCCTAAGAAGTACTCAGCCAGGTATATATGTTCTCTAGTGGCTGATTTTCATCGGACTCTGTTATATGGT
GGCGTAGCAATGAATCCAAGAAACCACCTTCGACTTGTTTATGAAGCAAATCCTCTGAGTTTCTTAGCGGAAAAGGCTGGAGGTAGAGGTTCAGATGGTA
AAAATAGAATTTTATCTATTCAACCTGTCAAGCTACACCAAAGACTTCCTCTATTTTTGGGAAGTTTGGAGGATATAGAAGAATTACAGAGTTATGGAGA
TGTTCAGCAGAAAGTGAACCCTGGTTATGATGTTTAATGCCCTTGTCCCTCTTTCATGCAGTTTGCTCATCTCTCTTTGACATGTAAATTTTTTTGCTTG
TTAGCTAGTAAATATGCTCTTCACTAGAATAAACATGTGATTTTCTATACCTACTCTTGAATATTGTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.971268
Expected error %
0.522684
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g64380.1 Score 245 E Value 3e-80 Identity 86.50% Align. Length 631bp (82.16%) Frame 1
68418.m08087 fructose-1,6-bisphosphatase family protein similar to SP|P22418 Fructose-1,6-bisphosphatase, chloroplast precursor (EC 3.1.3.11) (D-fructose-1,6-bisphosphate 1-phosphohydrolase) (FBPase) {Spinacia oleracea}; contains Pfam profile PF00316: fructose-1,6-bisphosphatase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g54050.1 Score 137 E Value 3e-39 Identity 55.40% Align. Length 592bp (77.08%) Frame 1
68416.m05976 fructose-1,6-bisphosphatase, putative / D-fructose-1,6-bisphosphate 1-phosphohydrolase, putative / FBPase, putative strong similarity to fructose-1,6-bisphosphatase [Brassica napus] GI:289367; identical to SP|P25851 Fructose-1,6-bisphosphatase, chloroplast precursor (EC 3.1.3.11) (D-fructose-1,6-bisphosphate 1-phosphohydrolase) (FBPase) {Arabidopsis thaliana}; contains Pfam profile PF00316: fructose-1,6-bisphosphatase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD45378.1| Score 258 E Value 9e-84 Identity 91.00% Align. Length 631bp (82.16%) Frame 1
putative ructose 1,6-bisphosphatase [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAM63051.1| Score 245 E Value 1e-78 Identity 86.50% Align. Length 631bp (82.16%) Frame 1
fructose-bisphosphatase-like protein [Arabidopsis thaliana] dbj|BAB09869.1| fructose-bisphosphatase-like protein [Arabidopsis thaliana] gb|AAM70586.1| AT5g64380/MSJ1_22 [Arabidopsis thaliana] ref|NP_201243.1| fructose-1,6-bisphosphatase family protein [Arabidopsis thaliana] gb|AAL32988.1| fructose-bisphosphatase-like protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0010D01
Clone
Clone name
hba-10d1
LE_HBa0010D01
C01HBa0010D01
P010D01
Clone type
BAC
Contamination
none
Estimated length
67,725
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found