Clone Read LE_HBa0061L10_T7_47779

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0061L10_T7_47779
Primer
T7
ID from Seq. Facility
LE_HBa_061_L10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
858 trimmed for vector and quality, 966 raw
Sequence
>LE_HBa0061L10_T7_47779 (raw untrimmed)
CTTGACTTGGGTCCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACTTGTTAGGCTAACTAAAAGAAATTTCCAAGCCATATTTGATAT
TTATATTATAGTCCGATTAACTAATTAATAATAATAAAAAAAAATTGCATAGACAATTTCTCTATGATACTTGATACCCAATTTTTATAATATTAGGCAA
AATGTTTATAATGTTGATGTCTAACACGTACAAGGGTGAATATGTAGATAAATATTAATATTCATAGTTGGTCTCTGTGACAATTCAATATCAAGAATTT
GTAATTACTTTTTTCGTTACAAAATAAGCATTATCTTAGTAAAAATTGTATCCGTTAATAAATAAAAATGCAATGGATAATTTACTAAATTATCCCAAAA
AAAGAATGATTCTATTTCCTTTTTAGTCTTTTTATAAAAGAATGACTCCTTTCATTTTTTTGCAACACTTTAACTTTAATTTTCTACATGACATGTTTAA
GACTACAAAATTAAAGAGTTTTTTGATACATTTAACATAATTTTAAATTAAAACCACAGGATTAAAAAGTCTTCTTTCTTTTTCTAAACTTCTTCTGATG
TCAAACTAAGTCAATCTTTTTGAAACGGAGGAAGTAATAAGCATATGGAGTAAAAAGTATAGTTTTATTATTTGTTCTTTAATTCTTAGGATAACACTTG
TGTTAAAGATAAATTTCTTTTGGCTAATGATGTATTTTTTTTATTAATAATCATTTGTAATATAAGTTATTCTTTCTTATAGATAAAACTTTGTGGGAAT
ACGCTCTTTTACGTGGAAGCTTATTGATCAGTCAATGGCAAACATGCAGGACCAATGAATGAATTTATATCTTCTCTTAAGAGTAAATAGCACAACGTAA
ACAAAAAAGCATAATAATCCAATTTACTTTGTGACCGCCCATCCGCAAATATATGGTTGCTTTAAC
>LE_HBa0061L10_T7_47779 (trimmed for quality and cloning vector)
AGCTTAACTTGTTAGGCTAACTAAAAGAAATTTCCAAGCCATATTTGATATTTATATTATAGTCCGATTAACTAATTAATAATAATAAAAAAAAATTGCA
TAGACAATTTCTCTATGATACTTGATACCCAATTTTTATAATATTAGGCAAAATGTTTATAATGTTGATGTCTAACACGTACAAGGGTGAATATGTAGAT
AAATATTAATATTCATAGTTGGTCTCTGTGACAATTCAATATCAAGAATTTGTAATTACTTTTTTCGTTACAAAATAAGCATTATCTTAGTAAAAATTGT
ATCCGTTAATAAATAAAAATGCAATGGATAATTTACTAAATTATCCCAAAAAAAGAATGATTCTATTTCCTTTTTAGTCTTTTTATAAAAGAATGACTCC
TTTCATTTTTTTGCAACACTTTAACTTTAATTTTCTACATGACATGTTTAAGACTACAAAATTAAAGAGTTTTTTGATACATTTAACATAATTTTAAATT
AAAACCACAGGATTAAAAAGTCTTCTTTCTTTTTCTAAACTTCTTCTGATGTCAAACTAAGTCAATCTTTTTGAAACGGAGGAAGTAATAAGCATATGGA
GTAAAAAGTATAGTTTTATTATTTGTTCTTTAATTCTTAGGATAACACTTGTGTTAAAGATAAATTTCTTTTGGCTAATGATGTATTTTTTTTATTAATA
ATCATTTGTAATATAAGTTATTCTTTCTTATAGATAAAACTTTGTGGGAATACGCTCTTTTACGTGGAAGCTTATTGATCAGTCAATGGCAAACATGCAG
GACCAATGAATGAATTTATATCTTCTCTTAAGAGTAAATAGCACAACGTAAACAAAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.900207
Expected error %
0.498912
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0061L10
Clone
Clone name
hba-61l10
LE_HBa0061L10
P061L10
Clone type
BAC
Contamination
none
Estimated length
74,624
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found