Clone Read LE_HBa0061L22_T7_47803

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0061L22_T7_47803
Primer
T7
ID from Seq. Facility
LE_HBa_061_L22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
808 trimmed for vector and quality, 901 raw
Sequence
>LE_HBa0061L22_T7_47803 (raw untrimmed)
TAAACTCGGGTCCCGTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATTGATTATTTTCTTTTAGGGTTGGAGAGGGAGGGGTAAATGATCGA
TTTTTTTGTTATTAAAAAGTTAAGATATTAGATTTTTTATATTTATTAGTCATGTTTTATTATTATTGGTGTAATTATTTATGTAATGATGTTTCTCAAA
TAGTAGTTCTAATACTTTTTTCTTATTATAGATTATCAACACTTATCCCAAATAAAAATCATAATATAATTTCTATATATTATAATTTTTTCATAAAAAA
TTATTTATAAAATTATTGAAAGAAAGTTGATTAATAATAGAACTATAAAGTTTAATATACATGAGACTATAAATGTCTCGCCTCACAACCCTACCTTTTA
AAACACTGTATTATAACTATAGTACCCCTATTGTAATGAAATCTTACTTCACAATACCTCATGTGGTGGGATGAGAGGGAGTCTGAAGGAAAAGAACATC
ACAAATTGTATAACTTATCAATTTTACCAAATGAGCAAATATAATTTATAAATAAGATATCAGAATATCTTAATACGCTGATTAAATTAATTTATAAATA
AACTTTTTTCATTACAAATTTCCAAATACATGTAATAATATTAATAGAGATTCATTAGTCTACCATAGTAATAACTAAATACGTATTTAATATAATTATT
TTATATGATATTGCAATAATCTCTTCGTGTTGTTTTATGAATATTTTTTGCAAAATTAAAATATAATTTCTAGTTACATATACAACTGTTTAATTAAATA
AATAATAATTTCAAATTAGGGCATTTTAGGCGGCTCAATATAATTGCACCGGTTTGCCCGTCTGCTGTGTTTGTTTAAAATATCACAAAATAATCATTTT
A
>LE_HBa0061L22_T7_47803 (trimmed for quality and cloning vector)
AGCTTATTGATTATTTTCTTTTAGGGTTGGAGAGGGAGGGGTAAATGATCGATTTTTTTGTTATTAAAAAGTTAAGATATTAGATTTTTTATATTTATTA
GTCATGTTTTATTATTATTGGTGTAATTATTTATGTAATGATGTTTCTCAAATAGTAGTTCTAATACTTTTTTCTTATTATAGATTATCAACACTTATCC
CAAATAAAAATCATAATATAATTTCTATATATTATAATTTTTTCATAAAAAATTATTTATAAAATTATTGAAAGAAAGTTGATTAATAATAGAACTATAA
AGTTTAATATACATGAGACTATAAATGTCTCGCCTCACAACCCTACCTTTTAAAACACTGTATTATAACTATAGTACCCCTATTGTAATGAAATCTTACT
TCACAATACCTCATGTGGTGGGATGAGAGGGAGTCTGAAGGAAAAGAACATCACAAATTGTATAACTTATCAATTTTACCAAATGAGCAAATATAATTTA
TAAATAAGATATCAGAATATCTTAATACGCTGATTAAATTAATTTATAAATAAACTTTTTTCATTACAAATTTCCAAATACATGTAATAATATTAATAGA
GATTCATTAGTCTACCATAGTAATAACTAAATACGTATTTAATATAATTATTTTATATGATATTGCAATAATCTCTTCGTGTTGTTTTATGAATATTTTT
TGCAAAATTAAAATATAATTTCTAGTTACATATACAACTGTTTAATTAAATAAATAATAATTTCAAATTAGGGCATTTTAGGCGGCTCAATATAATTGCA
CCGGTTTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.880012
Expected error %
0.733094
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0061L22
Clone
Clone name
hba-61l22
LE_HBa0061L22
C03HBa0061L22
P061L22
Clone type
BAC
Contamination
none
Estimated length
115,416
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found