Clone Read LE_HBa0063A22_T7_48043

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0063A22_T7_48043
Primer
T7
ID from Seq. Facility
LE_HBa_063_A22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
770 trimmed for vector and quality, 868 raw
Sequence
>LE_HBa0063A22_T7_48043 (raw untrimmed)
TCTACCTGGGTACCCGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCGTCAACATTACAATAAATTTAGTGTCCATTCTTGAATTTGGAAGAT
GAATAGAGGGATAAACTAAAGAATGTAAGTTGTGTGTTCATTCTAGAGTAAGTTCTTGATTGTTATGTATGTATAATAATTTTATACCTATTGAACACAT
TTGATTGACATGCAAGAAAAATATATAGTTCACTTTTATTGGTTTATACCTAACCCTATTCGACAATGTATTTAGGTTGTCAATAATGGTAGGATATTAG
AGGTTGGAAGACTATGATCGTAAAATGAACCTTGCCAACCCGCAATAAGTTATCCTTTTGAACCTCGAAATAGAAACACATTGAACCAAGATTCAATTTA
TGTTACAACCTTAGGATTGTGTTGGGGCATACGGTGTCAAAGCGAGGGATGGAAGTCAATCGTGCTATAGGGGAAGTTATTGAAAAGCTTCCCCCTCCCA
ATTATGTAAAAGGGGTGCGGAGTTTTCTTTGTCATTCTGGGTTCTACAGGAGATTTATCAAAGATTTTTCCAAGATTGCTAGAACTATGTGCATTCTTTT
GGAGAAGGGGGTGAAATTTGTATTCGATGAAAAGTGAATGCAAGCTTTCGCAGAATTGAAAAACTAGCTCATAGAAGCCCCACTTTTTACATCTCAATAT
TAGGAGCTCCCTTTTGAGTTGATGTGTGATGTAGTTATATGGCGGTAGGAAAGGTGCTAGGATAGAGAAAAAAGAAGGTGTTTCACTCAATATACTATGC
AAGCAAAACACTAGATGTAGTCCAAGCCATTACATTGTGAATCTAAAAGAATGCCAACACTGGTGCGT
>LE_HBa0063A22_T7_48043 (trimmed for quality and cloning vector)
AGCTTCGTCAACATTACAATAAATTTAGTGTCCATTCTTGAATTTGGAAGATGAATAGAGGGATAAACTAAAGAATGTAAGTTGTGTGTTCATTCTAGAG
TAAGTTCTTGATTGTTATGTATGTATAATAATTTTATACCTATTGAACACATTTGATTGACATGCAAGAAAAATATATAGTTCACTTTTATTGGTTTATA
CCTAACCCTATTCGACAATGTATTTAGGTTGTCAATAATGGTAGGATATTAGAGGTTGGAAGACTATGATCGTAAAATGAACCTTGCCAACCCGCAATAA
GTTATCCTTTTGAACCTCGAAATAGAAACACATTGAACCAAGATTCAATTTATGTTACAACCTTAGGATTGTGTTGGGGCATACGGTGTCAAAGCGAGGG
ATGGAAGTCAATCGTGCTATAGGGGAAGTTATTGAAAAGCTTCCCCCTCCCAATTATGTAAAAGGGGTGCGGAGTTTTCTTTGTCATTCTGGGTTCTACA
GGAGATTTATCAAAGATTTTTCCAAGATTGCTAGAACTATGTGCATTCTTTTGGAGAAGGGGGTGAAATTTGTATTCGATGAAAAGTGAATGCAAGCTTT
CGCAGAATTGAAAAACTAGCTCATAGAAGCCCCACTTTTTACATCTCAATATTAGGAGCTCCCTTTTGAGTTGATGTGTGATGTAGTTATATGGCGGTAG
GAAAGGTGCTAGGATAGAGAAAAAAGAAGGTGTTTCACTCAATATACTATGCAAGCAAAACACTAGATGT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.955521
Expected error %
0.0837433
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 117 E Value 4e-25 Identity 19.00% Align. Length 314bp (40.78%) Frame 3
putative reverse transcriptase [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAX95925.1| Score 113 E Value 5e-24 Identity 18.40% Align. Length 314bp (40.78%) Frame 3
retrotransposon protein, putative, Ty3-gypsy sub-class [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0063A22
Clone
Clone name
hba-63a22
LE_HBa0063A22
P063A22
Clone type
BAC
Contamination
none
Estimated length
87,752
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found