Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

Clone Read LE_HBa0063E16_SP6_48222

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0063E16_SP6_48222
Primer
SP6
ID from Seq. Facility
LE_HBa_063_E16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
774 trimmed for vector and quality, 986 raw
Sequence
>LE_HBa0063E16_SP6_48222 (raw untrimmed)
AAAAAAAATGGTTTTCTTTTGCTAGTGATGATACAAAGACTCCACCATTCTCTAATTTTTTCCACAAAACCCTCCGTGTTGAGCCCTAATTATCAAACTT
GAAATAGGATTTGTTTTGCTCCCCCTCTCCAGATTGTAGAGCAATGAGACTGCGATCTGAGCACAATCTCTATAACACCACTTGTTGAATTCTGCTAACC
TTGGCATCCTACTACTGGGTTTTACAATTGAAGATTAAATTTGATCTTCTCCCACCTCCACTCCCTCTTACGATTTGTTCTGCCATGTTCCTATTTGGAA
ATACGAAGAGGAACATGTTGTTGGCCATCTCGTAAATGTTGATCCCAAACACTCCTTTCCAAGAGACTGCAATCCATATCCTGAGGTCTAATAAAGAGGG
AAGTTGTGTTTCTCCCTCATTTTTTTAGCCCACAATGCACCTCTTGAAAAGTCCAGTGTCTCTTGCCCCTAGTGTCTATGTATCTTGAAAGTTTCCTTCC
CTGTACGAGATCTTAGTCTCACCCGAAGTGTTTGATCTCCATTTGCTTTCCCCACCTTATGTGGCATAAGAGAGGTCCTTCTTAAAAAGTTTGGGTTGTA
CTGCATTCTTCAGTTGGTGAGAGCATTGAATGAACCTCTTTATCTTAGAGGCTATCTCAATGTTTTGGGAGGGGAGAAGCAGAAAAAAGCGACGAGGGCT
TGCTTCACAGAAGCGAGAAGCGTGAAGCAAAGCGCGCGCTTTTTTTTTTTTTTTAAAAAAAAGTGACATTTAGTATAAAAATAAAAAAATATTAAATAAC
TAAATAGAGGTAATATAGTCTTAGATTAAAGAAAATAGATAGTAAATTATACTCATTAGTCATACCATTAAAACAAAAAACAAAAATATAATTAATTACA
AGACTCAACTCCTATTCTTCACAAAACCTCAACCTTTCAGGGCCTAACCAGGGTTTATTGGTAATATCTTTTCATTATAAAAATAA
>LE_HBa0063E16_SP6_48222 (trimmed for quality and cloning vector)
AAAGACTCCACCATTCTCTAATTTTTTCCACAAAACCCTCCGTGTTGAGCCCTAATTATCAAACTTGAAATAGGATTTGTTTTGCTCCCCCTCTCCAGAT
TGTAGAGCAATGAGACTGCGATCTGAGCACAATCTCTATAACACCACTTGTTGAATTCTGCTAACCTTGGCATCCTACTACTGGGTTTTACAATTGAAGA
TTAAATTTGATCTTCTCCCACCTCCACTCCCTCTTACGATTTGTTCTGCCATGTTCCTATTTGGAAATACGAAGAGGAACATGTTGTTGGCCATCTCGTA
AATGTTGATCCCAAACACTCCTTTCCAAGAGACTGCAATCCATATCCTGAGGTCTAATAAAGAGGGAAGTTGTGTTTCTCCCTCATTTTTTTAGCCCACA
ATGCACCTCTTGAAAAGTCCAGTGTCTCTTGCCCCTAGTGTCTATGTATCTTGAAAGTTTCCTTCCCTGTACGAGATCTTAGTCTCACCCGAAGTGTTTG
ATCTCCATTTGCTTTCCCCACCTTATGTGGCATAAGAGAGGTCCTTCTTAAAAAGTTTGGGTTGTACTGCATTCTTCAGTTGGTGAGAGCATTGAATGAA
CCTCTTTATCTTAGAGGCTATCTCAATGTTTTGGGAGGGGAGAAGCAGAAAAAAGCGACGAGGGCTTGCTTCACAGAAGCGAGAAGCGTGAAGCAAAGCG
CGCGCTTTTTTTTTTTTTTTAAAAAAAAGTGACATTTAGTATAAAAATAAAAAAATATTAAATAACTAAATAGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.970324
Expected error %
0.501049
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0063E16
Clone
Clone name
hba-63e16
LE_HBa0063E16
C12HBa0063E16
P063E16
Clone type
BAC
Contamination
none
Estimated length
97,984
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found