Clone Read LE_HBa0064C01_SP6_48864

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0064C01_SP6_48864
Primer
SP6
ID from Seq. Facility
LE_HBa_064_C01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
615 trimmed for vector and quality, 806 raw
Sequence
>LE_HBa0064C01_SP6_48864 (raw untrimmed)
AAAAAGGAAACTCACTCGAATTCCTTTCGTTCCTTTCCCAGTGGAGCCTTCGTCTCCTCTTTTTTCTTATACAAGAATAAATATATGCCTCCTCTCTCTG
TTCTTGTAAGCTTTGCCTTTTGTCTATTCTTTTTCATGGAGCAACCAGATCTCGTGGCAACTTTGTTAGAGAAAAAGTCGTCAACTTTCAGGGCCAACGG
CCATGAAAGTGATATCTTCTTCCCCAATTTTTTTCTTGGTTGTGGTCAAAGTATGCAATTCGGATTGACCGAATCCAAAACACACCTCACATTCGCGACC
GCACCAGTGTCGCGTCAAGACGGGTTCGGCTACAAAAATGAAGAGACTGCGCAACATAGATCCCAATTGATTATTTTTAACGTGTTGGCTCGTCTTGTAT
TGTCCACACTTGAGATGCCTAGTCTTGGTCCCACATTGTTTGTGGAAGGGAACAAGGAATCCTTATATGGTCTTGGGGTATCCTACCCTTATCACTTATG
ATCTAACTTTTAGGGTTGAGTTAGGCCCAAGCTCCATTTGTTTATCACTATATTAGATCAAGGCTCATCCCAATTCATTATTTTTAATGTTGTGCGGTTG
GGCCTCCCGTCTTATATTGTGGATGTCTAATCCTGAGTGTGGAGGGGTTGGGGGATGGGTGTGAGGTCTGGGTATATACACTCCCCTGCGCTTTATTCAT
CGTCCCCCATTTGTGCCAGGGCTAGCTCTCCCTCGTTTTCCCTTACTTCCCTCTTTCTTTCTTTATATTTTTTGGTTCATCAGTTTAACCCTTTTTGTTT
TTTATC
>LE_HBa0064C01_SP6_48864 (trimmed for quality and cloning vector)
GAGCCTTCGTCTCCTCTTTTTTCTTATACAAGAATAAATATATGCCTCCTCTCTCTGTTCTTGTAAGCTTTGCCTTTTGTCTATTCTTTTTCATGGAGCA
ACCAGATCTCGTGGCAACTTTGTTAGAGAAAAAGTCGTCAACTTTCAGGGCCAACGGCCATGAAAGTGATATCTTCTTCCCCAATTTTTTTCTTGGTTGT
GGTCAAAGTATGCAATTCGGATTGACCGAATCCAAAACACACCTCACATTCGCGACCGCACCAGTGTCGCGTCAAGACGGGTTCGGCTACAAAAATGAAG
AGACTGCGCAACATAGATCCCAATTGATTATTTTTAACGTGTTGGCTCGTCTTGTATTGTCCACACTTGAGATGCCTAGTCTTGGTCCCACATTGTTTGT
GGAAGGGAACAAGGAATCCTTATATGGTCTTGGGGTATCCTACCCTTATCACTTATGATCTAACTTTTAGGGTTGAGTTAGGCCCAAGCTCCATTTGTTT
ATCACTATATTAGATCAAGGCTCATCCCAATTCATTATTTTTAATGTTGTGCGGTTGGGCCTCCCGTCTTATATTGTGGATGTCTAATCCTGAGTGTGGA
GGGGTTGGGGGATGG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.97437
Expected error %
0.0214807
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0064C01
Clone
Clone name
hba-64c1
LE_HBa0064C01
P064C01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found