Clone Read LE_HBa0064C01_T7_48865

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0064C01_T7_48865
Primer
T7
ID from Seq. Facility
LE_HBa_064_C01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
682 trimmed for vector and quality, 790 raw
Sequence
>LE_HBa0064C01_T7_48865 (raw untrimmed)
TGGGTCCCGTCGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGAGCTTGTCCGTGGAGTGCCAAATGAGGCTGATGCTTCGGTATGGGGAGCA
TTGTTTTTCGCTTGTCGAGTTCACAGGAACATTGAGATGGGGGAAAAGGCAGCTCTGAAACTTCTTGAATTGGATCCTGGTGATAGTGGAACTTATGTCT
TACTTGCTAACATGTATGTTGAAGCAAATATGCAACATAAGGCACGAGATGTGAGGAAGATGATGGGTGAAAGAGGATTACAAAAAACACCTGGTTGCAG
CTCTGTTGAAGTAAATGGAAATATTTTTGAGTTTTTTGTTACAGACAAGACACATCCTCAGTCCGATCAGATTTATGAATGTTTGATTCAGTTAACAGGA
CACATTGAAATAGCTGAATATCTGCCATATATCAGATACGACCTGTTATTTAATTCTGATGTTTACAGTGCAATGTAAGAAAATCTGATTCGTCAGTCAC
CAAACCTACGTAGACAACAGAAGGGCTTGGTCCTGCTAAAGATGTTCAAATGATTAGGAGGGCAGGAGTTGAGTTGCAACCTAAAGGCCACGGTAACGAC
TTAACCCGCTCCTCTGTTCTACTGAGGCACTGTGAATACAGACAGCTCAAGGATGGATCTAAATGTTCTTTTGTTTTAACTGGAGGCATCACTACTAACT
GTGAATACAGTGCTCAAGCTTAACTAGCCTGTGCACGCCCCAGTGGTGGAAGCCACATCTCAGCCAGAAATGTTTTTCGAAACCAACCCA
>LE_HBa0064C01_T7_48865 (trimmed for quality and cloning vector)
AGCTTATGAGCTTGTCCGTGGAGTGCCAAATGAGGCTGATGCTTCGGTATGGGGAGCATTGTTTTTCGCTTGTCGAGTTCACAGGAACATTGAGATGGGG
GAAAAGGCAGCTCTGAAACTTCTTGAATTGGATCCTGGTGATAGTGGAACTTATGTCTTACTTGCTAACATGTATGTTGAAGCAAATATGCAACATAAGG
CACGAGATGTGAGGAAGATGATGGGTGAAAGAGGATTACAAAAAACACCTGGTTGCAGCTCTGTTGAAGTAAATGGAAATATTTTTGAGTTTTTTGTTAC
AGACAAGACACATCCTCAGTCCGATCAGATTTATGAATGTTTGATTCAGTTAACAGGACACATTGAAATAGCTGAATATCTGCCATATATCAGATACGAC
CTGTTATTTAATTCTGATGTTTACAGTGCAATGTAAGAAAATCTGATTCGTCAGTCACCAAACCTACGTAGACAACAGAAGGGCTTGGTCCTGCTAAAGA
TGTTCAAATGATTAGGAGGGCAGGAGTTGAGTTGCAACCTAAAGGCCACGGTAACGACTTAACCCGCTCCTCTGTTCTACTGAGGCACTGTGAATACAGA
CAGCTCAAGGATGGATCTAAATGTTCTTTTGTTTTAACTGGAGGCATCACTACTAACTGTGAATACAGTGCTCAAGCTTAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.974763
Expected error %
0.390169
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g22410.1 Score 150 E Value 5e-37 Identity 18.00% Align. Length 410bp (60.12%) Frame 3
68415.m02657 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g21300.1 Score 114 E Value 4e-26 Identity 14.30% Align. Length 383bp (56.16%) Frame 3
68417.m03077 pentatricopeptide (PPR) repeat-containing protein contains INTERPRO:IPR002885 PPR repeats
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAD22358.1| Score 150 E Value 2e-35 Identity 18.00% Align. Length 410bp (60.12%) Frame 3
hypothetical protein [Arabidopsis thaliana] gb|AAL57637.1| At2g22410/F14M13.19 [Arabidopsis thaliana] ref|NP_179827.1| pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] pir||C84612 hypothetical protein At2g22410 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP53645.1| Score 148 E Value 1e-34 Identity 19.40% Align. Length 365bp (53.52%) Frame 3
putative selenium-binding protein-like [Oryza sativa (japonica cultivar-group)] ref|NP_921358.1| putative selenium-binding protein-like [Oryza sativa (japonica cultivar-group)] gb|AAK50416.1| Putative selenium-binding protein-like [Oryza sativa]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0064C01
Clone
Clone name
hba-64c1
LE_HBa0064C01
P064C01
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found