Clone Read LE_HBa0010G02_SP6_4898

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0010G02_SP6_4898
Primer
SP6
ID from Seq. Facility
LE_HBa_010_G02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
761 trimmed for vector and quality, 938 raw
Genbank Accession
Sequence
>LE_HBa0010G02_SP6_4898 (raw untrimmed)
TTATTCCGGAAATGCCCCTTTGTGTTGGGTTCCTCCCGAGCCTGGAAGACCCTTTGAAGGGTATATGTCAGTACTGGATAATTCTTTTGGTCCTGTACTT
GGTTAGCATGATGACACTGGGAAGAAAGAGCGGGCTATTTATTACCTCAGCAAGAAGTTTACCGTTTACAAAGCGAAGTACACCCTTCTTGAAAGAACGT
GTTGTGCCCTAACTAGCACAGAAGTTGAAACATTATCTTTCATCTTACACTACTTATCTCATCTCTCGTATGGATCCGTTGAAATATATTTTTCAAAAGC
CAATGCCCACAGGCAGGCTTGTGAAATGACAAATATTGCTCACAGAGTTTGACATTATCTATATAACGTGGACCACAATGAAAGCTCAAGCATTGGCAAA
TCATTTGGCAGAGAACCCTATTGATGAAGAATATGAACCACTTAAAACCTATTTTCCAGATAAAGAGATATCTTGTATCGATGAAGTTATTCACGATAAC
AATCAAGGTTGGAAGTTATTCTTTGATGGTGCCTCTAACAGGAAAGGAGTTGGAATATGAGTTGCTCTTATGTCTGAATCAGGGGAGTATTACCCTATAT
CAACCCAACTTATATTAGTGTACTAATAATATGTCTGAGTATGAAGCGTGCATTTTGGGTCTAAGGTTAGCGGTTGACATGGGTATCCAAGAATTGTTAG
TGTTAGGAGACTCAGACTTACTAGTTCATCAAATTCAAGGAGAATGGGAAACTCGAGACCTAAAGCTCATACCATATCAACATTGTTTACAAGGTCTTTG
TCAACAATTTGTGTCGATAAAGTTTAGACACATTCCCAGAGTACACGATGAGATTGCAATGCATTGGCCACTTTATCTTCAATGCTCAACACCCTGATGG
GGTCATTTCACCCTTTAACATACCAATTCGTGATCACA
>LE_HBa0010G02_SP6_4898 (trimmed for quality and cloning vector)
TTCCTCCCGAGCCTGGAAGACCCTTTGAAGGGTATATGTCAGTACTGGATAATTCTTTTGGTCCTGTACTTGGTTAGCATGATGACACTGGGAAGAAAGA
GCGGGCTATTTATTACCTCAGCAAGAAGTTTACCGTTTACAAAGCGAAGTACACCCTTCTTGAAAGAACGTGTTGTGCCCTAACTAGCACAGAAGTTGAA
ACATTATCTTTCATCTTACACTACTTATCTCATCTCTCGTATGGATCCGTTGAAATATATTTTTCAAAAGCCAATGCCCACAGGCAGGCTTGTGAAATGA
CAAATATTGCTCACAGAGTTTGACATTATCTATATAACGTGGACCACAATGAAAGCTCAAGCATTGGCAAATCATTTGGCAGAGAACCCTATTGATGAAG
AATATGAACCACTTAAAACCTATTTTCCAGATAAAGAGATATCTTGTATCGATGAAGTTATTCACGATAACAATCAAGGTTGGAAGTTATTCTTTGATGG
TGCCTCTAACAGGAAAGGAGTTGGAATATGAGTTGCTCTTATGTCTGAATCAGGGGAGTATTACCCTATATCAACCCAACTTATATTAGTGTACTAATAA
TATGTCTGAGTATGAAGCGTGCATTTTGGGTCTAAGGTTAGCGGTTGACATGGGTATCCAAGAATTGTTAGTGTTAGGAGACTCAGACTTACTAGTTCAT
CAAATTCAAGGAGAATGGGAAACTCGAGACCTAAAGCTCATACCATATCAACATTGTTTAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.971764
Expected error %
0.3663
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU90285.1| Score 233 E Value 2e-88 Identity 83.50% Align. Length 757bp (99.47%) Frame 1
putative gag/pol polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 207 E Value 5e-76 Identity 86.60% Align. Length 757bp (99.47%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0010G02
Clone
Clone name
hba-10g2
LE_HBa0010G02
P010G02
Clone type
BAC
Contamination
none
Estimated length
115,012
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found