Clone Read LE_HBa0064H04_SP6_49110

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0064H04_SP6_49110
Primer
SP6
ID from Seq. Facility
LE_HBa_064_H04-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
758 trimmed for vector and quality, 809 raw
Sequence
>LE_HBa0064H04_SP6_49110 (raw untrimmed)
AAAATAGTTACCCCCTTAAANNGTATTTTTAAAATATATACTAGTGTAACTTTTTAAGTATATTATAGCTTGTTTGGTAAGGATTTTATTAGATTTTAAA
GTGCTAATTTGTTTTAGAACATAAATAACTTAATTTTATAAAAAGGGTTAGTTCATATTTTTGGCCCCTCAATTATGGATATAATATATCCCATTAATTC
GTTTTCCCTTTTAATTTCATTAAACATAATATAACAAATGAACACTTTATAGGGCAATTTTATTTTATTATTTTATCATATAATAAAAGTGAATGTGCAT
ATTCTATTCATCCATTGTAAGCATAATGTCATATGATTAATGTCATTGTTGTTGTCATTGCAGAGTCATCTCTCAATAACTGATTTTGTAGTTTTGCACA
CTATGTAGCTTCTGATTTTTCTTATCTATATTTTTCCATTTTAATAAAACATTTTTTATATTTATTTCATAATTGCAATTCAATTTTCTAATACATAATT
TTATTGCAGACATGCACTGGTGGAATATGATATTTTAAAATAATAGTTGGTAAACTTCCAATTAAGTTACTGCTATCTTGCGACAACATTTGATAACTTA
GACATATGAAAGCCTATATCAAATAATAGATACATGATATATGTTTGTTATATATATATATATAACAATTGTAGCTTTAGTTTATCTAATCTGCATATTG
TTATAGTTATGAGTTGATTTAATTCATTAGTTTGGCTCAAATCTTATAATTATGTTTTTAAAAAAAGTTATTTAATATATTTAAAATAAATAATTACGAT
TATAATCTA
>LE_HBa0064H04_SP6_49110 (trimmed for quality and cloning vector)
ATTTTTAAAATATATACTAGTGTAACTTTTTAAGTATATTATAGCTTGTTTGGTAAGGATTTTATTAGATTTTAAAGTGCTAATTTGTTTTAGAACATAA
ATAACTTAATTTTATAAAAAGGGTTAGTTCATATTTTTGGCCCCTCAATTATGGATATAATATATCCCATTAATTCGTTTTCCCTTTTAATTTCATTAAA
CATAATATAACAAATGAACACTTTATAGGGCAATTTTATTTTATTATTTTATCATATAATAAAAGTGAATGTGCATATTCTATTCATCCATTGTAAGCAT
AATGTCATATGATTAATGTCATTGTTGTTGTCATTGCAGAGTCATCTCTCAATAACTGATTTTGTAGTTTTGCACACTATGTAGCTTCTGATTTTTCTTA
TCTATATTTTTCCATTTTAATAAAACATTTTTTATATTTATTTCATAATTGCAATTCAATTTTCTAATACATAATTTTATTGCAGACATGCACTGGTGGA
ATATGATATTTTAAAATAATAGTTGGTAAACTTCCAATTAAGTTACTGCTATCTTGCGACAACATTTGATAACTTAGACATATGAAAGCCTATATCAAAT
AATAGATACATGATATATGTTTGTTATATATATATATATAACAATTGTAGCTTTAGTTTATCTAATCTGCATATTGTTATAGTTATGAGTTGATTTAATT
CATTAGTTTGGCTCAAATCTTATAATTATGTTTTTAAAAAAAGTTATTTAATATATTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.871054
Expected error %
0.28557
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0064H04
Clone
Clone name
hba-64h4
LE_HBa0064H04
P064H04
Clone type
BAC
Contamination
none
Estimated length
104,804
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found