Clone Read LE_HBa0064H04_T7_49111

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0064H04_T7_49111
Primer
T7
ID from Seq. Facility
LE_HBa_064_H04-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
767 trimmed for vector and quality, 810 raw
Sequence
>LE_HBa0064H04_T7_49111 (raw untrimmed)
CTGGGTCCCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGGATGTGAGTCAAGTTGCTTTCAAGACTATTCTCAATTTGTTGTCACACAC
ACTTTTCTCCAAGGACTTGGCTAACACTTCTTCGGATTCAAAGGTAGAGTTTGAACAATGCATTTGATATACTAAAATGTTTATGACATACGTTTTTTTT
AAAATTTAAAGGTTGATGAGTTGAAGGAGGTTATCTGGCGCATCATGAATGAGGTTGGGAAGATCAACCTAGTGGATTTTTTCCCCATACTTGAAAAGAT
TGATTTTCAAGGAATAAGGTGTCGTGCAACCATTCATATTGGTAAGTTGTTTGAACTTTTTGATGGTTTGATCAATGAGCGATTGGAGGAAAAGAGAAGG
GGATGCTATGGAAAGAGTGATGTTCTAGAAGTGCTTCTCAACGCAGAAAATACTGAAGAGATCGATCAGAATCATATAAAATCCATGCTCCTGGTTCTCT
CTTTTATCCCTTCTTTAACTTTTTAACAAGACTCAAGTAATCATATGTCCTCGATCGAGGCAAAACAGAGAAAGTTTTCCACTACAAATGAAAAGAATAA
TAATATAAGTACAACTATTATATATTAGTCCAAACTTACAAGAAAATTGTTTTCTCAAACTTATAACAAATAATGGATTTTTCAAACCTATAAGGAGTAT
TTTTCCCAAACCTAGCTAGTATATAATATTATATAGCTTTTTTCTTGTATTGGTAACTAGTTGTATTCAAAAATGTTACAGGACTTATTTATTGGTTGGT
TTTGATACAA
>LE_HBa0064H04_T7_49111 (trimmed for quality and cloning vector)
AGCTTTGGATGTGAGTCAAGTTGCTTTCAAGACTATTCTCAATTTGTTGTCACACACACTTTTCTCCAAGGACTTGGCTAACACTTCTTCGGATTCAAAG
GTAGAGTTTGAACAATGCATTTGATATACTAAAATGTTTATGACATACGTTTTTTTTAAAATTTAAAGGTTGATGAGTTGAAGGAGGTTATCTGGCGCAT
CATGAATGAGGTTGGGAAGATCAACCTAGTGGATTTTTTCCCCATACTTGAAAAGATTGATTTTCAAGGAATAAGGTGTCGTGCAACCATTCATATTGGT
AAGTTGTTTGAACTTTTTGATGGTTTGATCAATGAGCGATTGGAGGAAAAGAGAAGGGGATGCTATGGAAAGAGTGATGTTCTAGAAGTGCTTCTCAACG
CAGAAAATACTGAAGAGATCGATCAGAATCATATAAAATCCATGCTCCTGGTTCTCTCTTTTATCCCTTCTTTAACTTTTTAACAAGACTCAAGTAATCA
TATGTCCTCGATCGAGGCAAAACAGAGAAAGTTTTCCACTACAAATGAAAAGAATAATAATATAAGTACAACTATTATATATTAGTCCAAACTTACAAGA
AAATTGTTTTCTCAAACTTATAACAAATAATGGATTTTTCAAACCTATAAGGAGTATTTTTCCCAAACCTAGCTAGTATATAATATTATATAGCTTTTTT
CTTGTATTGGTAACTAGTTGTATTCAAAAATGTTACAGGACTTATTTATTGGTTGGTTTTGATACAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.946228
Expected error %
0.32879
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g61040.1 Score 60 E Value 8e-13 Identity 38.30% Align. Length 454bp (59.19%) Frame 3
68416.m06830 cytochrome P450 family protein similar to cytochrome P450 monooxygenase - Arabidopsis thaliana, EMBL:D78600
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g61040.2 Score 60 E Value 8e-13 Identity 38.30% Align. Length 454bp (59.19%) Frame 3
68416.m06831 cytochrome P450 family protein similar to cytochrome P450 monooxygenase - Arabidopsis thaliana, EMBL:D78600
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAC53893.1| Score 127 E Value 3e-37 Identity 72.30% Align. Length 451bp (58.80%) Frame 3
cytochrome P450 [Petunia x hybrida]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAC80883.1| Score 104 E Value 2e-28 Identity 59.60% Align. Length 454bp (59.19%) Frame 3
geraniol 10-hydroxylase [Catharanthus roseus]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0064H04
Clone
Clone name
hba-64h4
LE_HBa0064H04
P064H04
Clone type
BAC
Contamination
none
Estimated length
104,804
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found