Clone Read LE_HBa0064M21_T7_49385

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0064M21_T7_49385
Primer
T7
ID from Seq. Facility
LE_HBa_064_M21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
742 trimmed for vector and quality, 809 raw
Sequence
>LE_HBa0064M21_T7_49385 (raw untrimmed)
CTTGGTCCCGCGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATCCATTTATTCTTGCTCCCAAGGTACTTGAATCCTTCTTGGCCTTTTTATT
GAAGCAATATCTTTAATTCACATGACATGACATGACAGGGTGGTGACACTGAATGGGTAACTCTACATCTTGACAACCCCAACCCATCACATGATGACTG
GGTTGGAGTTTTCTCTCCAGCAAAATTCAAGTATGTACTAATCTCTACTTCCTCGTTGTTGAATAAATTTGGAATGTTTATTTTGTACTCCTTTTGCATC
TCAGTGGATCTACATGTTATTTGGAAAATGATGGTAAACAACAGCCTCCATATATTTGTACAGCCCCAATAAAGGCAGGTGACTACAATTCAACTATAAT
TAGGAAAGGTGTTTGCAATTTCTAACCTAAATAAATAATGTGTCTCTCGCAGTATAACTTTGCAAATTTCTCCAATCCGGATTATGCAAAAACGGGAAAC
ACTTCTCTCAAGTTCCAGTTAATCAATCAGCGGGCAGATTTCTCCTTTGCATTGTTTACAGGCGGGTTGTCAAATGTCAGTTATATCTATGCTTAATCTT
TTTCATTCTCCACCCCAAATTTGTACTTGTATTTGTTTTAAAGCAAATGCCTACAAAAAATAAGACCTCCATACACCTTACCATTCAAACTCCACCATTT
GTTTGCTAGTCTTCGTCATGTTTCCTTAATACCATTCTATTTTGTTGCAGCCAAAGCTGGTAGGTGTTTCAAAATTACATTATCATTTTGCAAATCCCTA
AAACACCCC
>LE_HBa0064M21_T7_49385 (trimmed for quality and cloning vector)
AGCTTATCCATTTATTCTTGCTCCCAAGGTACTTGAATCCTTCTTGGCCTTTTTATTGAAGCAATATCTTTAATTCACATGACATGACATGACAGGGTGG
TGACACTGAATGGGTAACTCTACATCTTGACAACCCCAACCCATCACATGATGACTGGGTTGGAGTTTTCTCTCCAGCAAAATTCAAGTATGTACTAATC
TCTACTTCCTCGTTGTTGAATAAATTTGGAATGTTTATTTTGTACTCCTTTTGCATCTCAGTGGATCTACATGTTATTTGGAAAATGATGGTAAACAACA
GCCTCCATATATTTGTACAGCCCCAATAAAGGCAGGTGACTACAATTCAACTATAATTAGGAAAGGTGTTTGCAATTTCTAACCTAAATAAATAATGTGT
CTCTCGCAGTATAACTTTGCAAATTTCTCCAATCCGGATTATGCAAAAACGGGAAACACTTCTCTCAAGTTCCAGTTAATCAATCAGCGGGCAGATTTCT
CCTTTGCATTGTTTACAGGCGGGTTGTCAAATGTCAGTTATATCTATGCTTAATCTTTTTCATTCTCCACCCCAAATTTGTACTTGTATTTGTTTTAAAG
CAAATGCCTACAAAAAATAAGACCTCCATACACCTTACCATTCAAACTCCACCATTTGTTTGCTAGTCTTCGTCATGTTTCCTTAATACCATTCTATTTT
GTTGCAGCCAAAGCTGGTAGGTGTTTCAAAATTACATTATCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.953987
Expected error %
0.520951
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g13750.1 Score 72 E Value 7e-19 Identity 40.00% Align. Length 493bp (66.44%) Frame 1
68414.m01614 calcineurin-like phosphoesterase family protein contains Pfam profile: PF00149 calcineurin-like phosphoesterase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g50400.1 Score 70 E Value 4e-23 Identity 43.60% Align. Length 496bp (66.85%) Frame 1
68418.m06242 calcineurin-like phosphoesterase family protein contains Pfam profile: PF00149 calcineurin-like phosphoesterase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD12837.1| Score 75 E Value 2e-20 Identity 40.20% Align. Length 496bp (66.85%) Frame 1
putative metallophosphatase [Lupinus luteus]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAD12836.1| Score 74 E Value 5e-20 Identity 42.00% Align. Length 496bp (66.85%) Frame 1
diphosphonucleotide phosphatase 1 [Lupinus luteus]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0064M21
Clone
Clone name
hba-64m21
LE_HBa0064M21
C08HBa0064M21
P064M21
Clone type
BAC
Contamination
none
Estimated length
55,333
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found