Clone Read LE_HBa0065E22_SP6_49770

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0065E22_SP6_49770
Primer
SP6
ID from Seq. Facility
LE_HBa_065_E22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
722 trimmed for vector and quality, 899 raw
Sequence
>LE_HBa0065E22_SP6_49770 (raw untrimmed)
CGCGGGGGATTTTTGGGGCATCTCTTACCCTCCTAATCTTATTCAAAGTTAAACTAGAAACCCTCGAGACTAGTCTCATGATGGAAGTTGTATTGTACTC
GCTCTCTGACATTGCCATGTTAAATTGCTATTTAATTTTCTTTTTTTCCCACTTGTTCTTTTCTCCAATATATCTTCATTTCCTTCTATTTCGACATTAC
ATGATAACTTTCCACTCCATCAAATTCTCTGCAATCACCTATTTTACCCTTTCACTGCCATTAAGCTGCCACATTTCCTCCACTGCAAAACCCATTGCTG
TATTTTCTCCATTACAAAACTCTTGACCCCCACCCTATAACTCTCTCTCACAGGAAACCTCTCTGCACCTTCACCTATATATCCATTCCCCCAAACAGAC
CAAAGTCTCACCTTTCTCTCCATGGATTTTTTTTATACAGGCAGCTTCCATCCACAGAAAACCCAGGACAACTGTTCTCCATAGACGCTGCTTTCAACCC
CCAAAGCTACGGCAGAGACCTTCTTCCTTCCTTCACCCATTCTTCAGGATCAAAAGTTATATTTTGCTGGAATAGCTTGTGTTGTACTGTTGAGATGGAG
TATGTTCGAAAGCTTGTATTTTGAAATTGAATGTGATTGAACTGATATAATTATGAATTTTTAAGCACTCTTATTTTGGTTAATTCTACCTTATATGTTG
TCTAAAAATATTAAGTCACTCGGGTGTGGTTTGATATTTCAATAGATCTCATTAAAATACTCCACAGAGGAAAAAAGATTAGTCTTCCTTCTCTAATGAT
GTTTTTCAGAAGCAATCATTCTGCTGGACTTGGCTCTGGGAAAAAGGAAGTAAAAAACAGGAAAAAGAGAAAGTAAAGAACAGGAAAAAGGGAAAAAAG
>LE_HBa0065E22_SP6_49770 (trimmed for quality and cloning vector)
CTCTTACCCTCCTAATCTTATTCAAAGTTAAACTAGAAACCCTCGAGACTAGTCTCATGATGGAAGTTGTATTGTACTCGCTCTCTGACATTGCCATGTT
AAATTGCTATTTAATTTTCTTTTTTTCCCACTTGTTCTTTTCTCCAATATATCTTCATTTCCTTCTATTTCGACATTACATGATAACTTTCCACTCCATC
AAATTCTCTGCAATCACCTATTTTACCCTTTCACTGCCATTAAGCTGCCACATTTCCTCCACTGCAAAACCCATTGCTGTATTTTCTCCATTACAAAACT
CTTGACCCCCACCCTATAACTCTCTCTCACAGGAAACCTCTCTGCACCTTCACCTATATATCCATTCCCCCAAACAGACCAAAGTCTCACCTTTCTCTCC
ATGGATTTTTTTTATACAGGCAGCTTCCATCCACAGAAAACCCAGGACAACTGTTCTCCATAGACGCTGCTTTCAACCCCCAAAGCTACGGCAGAGACCT
TCTTCCTTCCTTCACCCATTCTTCAGGATCAAAAGTTATATTTTGCTGGAATAGCTTGTGTTGTACTGTTGAGATGGAGTATGTTCGAAAGCTTGTATTT
TGAAATTGAATGTGATTGAACTGATATAATTATGAATTTTTAAGCACTCTTATTTTGGTTAATTCTACCTTATATGTTGTCTAAAAATATTAAGTCACTC
GGGTGTGGTTTGATATTTCAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.945906
Expected error %
0.174929
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0065E22
Clone
Clone name
hba-65e22
LE_HBa0065E22
P065E22
Clone type
BAC
Contamination
none
Estimated length
107,135
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found