Clone Read LE_HBa0065E22_T7_49771

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0065E22_T7_49771
Primer
T7
ID from Seq. Facility
LE_HBa_065_E22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
249 trimmed for vector and quality, 782 raw
Sequence
>LE_HBa0065E22_T7_49771 (raw untrimmed)
TCTAGCTCGGTACCGCGGGGACCTCTAGAGTCGACTCGCAGGCATCGCAAGCTTGAGCCTTTTNGCTATAGACCCTTTTCGTTTCTTGAACTGTAAGTGG
CTTAGCTTTCTTTAGTCTTCAGTTATTATGTAACTTGCTACTGTATTGCTTACTGCTTTTTTTTTTTTTTTTTTTAAGTTGGGTGTGGTTGTTTTGGGCT
GGAGGGTTATAAAGTTTGGATTTTGAGGACTTTGTGAGTAAAGGGTTTACTTTTTTTGATTCTGTTGAGGATGGGGAGGGGTGAGGTGTGGATTANNNAN
NNNNTNNTNTNNNNNNNNNTTNNNNNNTTNNNNTTNTTTTTTNTNTTTTTTTNTTNTTTTTTTTTTTTTTTTTTTTNTTTTTTTTNTTNTTNTNNTTTNT
TTTTTTTTTTTTTTTTTTNTTTTTTTTNTTTTTTTTTTTTNTTTNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTNTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTTTTNTTTTTTTTTTTTTTTNNNTTTNTTTTTTNTTTTTTTTTNTTTTTNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTNTNT
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTNTTTTTTTTTTTTTTNTTTTTTTTTTTTTTTTNTTTTTTNTNNNTTTNTTTTTTTTTTNTTTTTNTNTTT
TTTTTTTTTTTNTTTTTNTTTTTTTTNTTTTNTTTTTTTTTTTTTTTTTTTTTTTNTTTTTTTTTNTTTTTTTTTTTTTTTT
>LE_HBa0065E22_T7_49771 (trimmed for quality and cloning vector)
CGCAAGCTTGAGCCTTTTNGCTATAGACCCTTTTCGTTTCTTGAACTGTAAGTGGCTTAGCTTTCTTTAGTCTTCAGTTATTATGTAACTTGCTACTGTA
TTGCTTACTGCTTTTTTTTTTTTTTTTTTTAAGTTGGGTGTGGTTGTTTTGGGCTGGAGGGTTATAAAGTTTGGATTTTGAGGACTTTGTGAGTAAAGGG
TTTACTTTTTTTGATTCTGTTGAGGATGGGGAGGGGTGAGGTGTGGATT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.884636
Expected error %
1.07313
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0065E22
Clone
Clone name
hba-65e22
LE_HBa0065E22
P065E22
Clone type
BAC
Contamination
none
Estimated length
107,135
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found