Clone Read LE_HBa0065I21_SP6_49960

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0065I21_SP6_49960
Primer
SP6
ID from Seq. Facility
LE_HBa_065_I21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
365 trimmed for vector and quality, 910 raw
Sequence
>LE_HBa0065I21_SP6_49960 (raw untrimmed)
CCGCGAGCTTTTGGGAAAGGTTGTGGTTGCCGTTTCTCACCCATAGTAGGATCGCATAAGTAACCCTGCGAACGAAGCACATTATCTCCCCTTGGGAGAA
AACCTCGACTTTCTATTAATGATCTCCACCTTTTAACTAAAGTAATAGCGGATCAATATCATGTTTTTCCTTAACCTCTGCTACCAGTGAAGATTCTGAT
CTATTCTATACTATCAGACAACCATCGGACATGTTCTTAAGACCCATTCCTACTGTGACCAAGCTGGTGAATATCTTCTGTGAATTCATCTCTTTATTTC
TCAACAAGTACTACACTACCCATAGACAGCCTGTTGAGAGCGTCAACCACTACATTGGCCATACCAAAATGGTAAAGCGCACTCCTGTTATAGTCTTTAA
GGAATTCAATTCATCTCCTATGATGAAGATTAAACTCTTTCTAGGTGAACACTGATCAAAGACATTAATGATCTGACAACACCCTACAAGCAATGTCTTT
AAATCATTAAGCAAATACTACAGTTGCAAGCTCAATGACATGAATGTGGTAGTTCTTCGCATGTACCTTAAGGGTGATAAAAGCAAAAGTTATGACGTTA
CCTCTTTGCATCAACACACAACGCTAGGCCAACCATGGATGTATCCTATTAAACAATATAAGCATCTGGTAAGATCATGACTGAAAGTGTAAGTAACTTG
GTCTTGAGTGTCAAGAATTTCTTCTTAAATATATCCGACTACTGAAATTTGACCCTTTTTGATTCACCATGGTAATGAGGAAACTAACGATGAAGTACTT
TAAAATCAGCTTAACCCTCCAAACCAGAAAGCTCTGATACTGGTACGAGGTGGGTTGGGAATTTCTTGTTTAGTTTTGTTTTGTATAATCCTGGGTTGTT
TGGTGGTGGN
>LE_HBa0065I21_SP6_49960 (trimmed for quality and cloning vector)
TCTCCCCTTGGGAGAAAACCTCGACTTTCTATTAATGATCTCCACCTTTTAACTAAAGTAATAGCGGATCAATATCATGTTTTTCCTTAACCTCTGCTAC
CAGTGAAGATTCTGATCTATTCTATACTATCAGACAACCATCGGACATGTTCTTAAGACCCATTCCTACTGTGACCAAGCTGGTGAATATCTTCTGTGAA
TTCATCTCTTTATTTCTCAACAAGTACTACACTACCCATAGACAGCCTGTTGAGAGCGTCAACCACTACATTGGCCATACCAAAATGGTAAAGCGCACTC
CTGTTATAGTCTTTAAGGAATTCAATTCATCTCCTATGATGAAGATTAAACTCTTTCTAGGTGAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959554
Expected error %
1.24169
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 70 E Value 1e-18 Identity 58.10% Align. Length 357bp (97.81%) Frame 3
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38790.1| Score 70 E Value 1e-18 Identity 58.10% Align. Length 357bp (97.81%) Frame 3
putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0065I21
Clone
Clone name
hba-65i21
LE_HBa0065I21
C03HBa0065I21
P065I21
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found