Clone Read LE_HBa0065M23_SP6_50156

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0065M23_SP6_50156
Primer
SP6
ID from Seq. Facility
LE_HBa_065_M23-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
613 trimmed for vector and quality, 878 raw
Sequence
>LE_HBa0065M23_SP6_50156 (raw untrimmed)
CGCCGGGTTTTTGGAGATCGAAAGATAAATACGAAGAGAAACACAGGAGGAGAAATTGGAGGAGCAACTGCTGGGGTAATTCAAGTTCCTCCCCAGGCTC
CAGGTTCTGAAATGGAGATGCCTGTTAACTCAACTAAGTTGAAAGATGGAGAAGTAATACAGCCCTGGTATAGATGGACCAAGCCATCACCTTACAAGCT
CAGGCTATGACAGCCCAGGCAGAGCAACAAGGTGTTCCTAGGGAAGAACCCACCTGCTAGCCCCATGGCTAACAAGTTAAGAGACTTCACGAGGATTAAT
CCTCCCATTTACGTTGAATCTAAGATTGTTGAGAATCTCGAGGACGAGTGTAGGACAACTATTATGTGTGAGAGCATGGACTTATCCTGTCTTATGGTTT
ATGTCCAACGAGTGGAGGAGAACAGGAAGAGGAAGCATAATAGGGCAGGGAAAAGGTCAAGGCAAGATGAGGAGAATTTTTCAAGGAAGAGTACTCTTCG
TCCAAGGGGAGTCGAGTTCAGCCAATGGTCTCTAGGATATGGATTCTTAGCCCAAAGTTAAGAGAAACAATGAGGTAGATACACCTTAGGAGAGACGACC
TTGCAGGAAGTGTGGAAAACTACATGGAGGAGGGTGTGTGATGAGAACTAAAGCTTTTTATAGTTGTGGCTAATGAGGTCCCATGGGTGAAGGATTGTCC
AATTTAGGAAAAGTAAACAACAAGGGGAAGGAGAGAGTGCAACCTAAGATTCCAAGGGAAGAGGCCCCAAGGAGGCAAGAGTCGTTCGCACTCAATTATA
GGGTACTAGAGAAGGCACTAGTGGAAAATCTCGAGTGGGTAAGATAAATAGTTATTTCTCCTTTATTGTTGTATTGAT
>LE_HBa0065M23_SP6_50156 (trimmed for quality and cloning vector)
ACGAAGAGAAACACAGGAGGAGAAATTGGAGGAGCAACTGCTGGGGTAATTCAAGTTCCTCCCCAGGCTCCAGGTTCTGAAATGGAGATGCCTGTTAACT
CAACTAAGTTGAAAGATGGAGAAGTAATACAGCCCTGGTATAGATGGACCAAGCCATCACCTTACAAGCTCAGGCTATGACAGCCCAGGCAGAGCAACAA
GGTGTTCCTAGGGAAGAACCCACCTGCTAGCCCCATGGCTAACAAGTTAAGAGACTTCACGAGGATTAATCCTCCCATTTACGTTGAATCTAAGATTGTT
GAGAATCTCGAGGACGAGTGTAGGACAACTATTATGTGTGAGAGCATGGACTTATCCTGTCTTATGGTTTATGTCCAACGAGTGGAGGAGAACAGGAAGA
GGAAGCATAATAGGGCAGGGAAAAGGTCAAGGCAAGATGAGGAGAATTTTTCAAGGAAGAGTACTCTTCGTCCAAGGGGAGTCGAGTTCAGCCAATGGTC
TCTAGGATATGGATTCTTAGCCCAAAGTTAAGAGAAACAATGAGGTAGATACACCTTAGGAGAGACGACCTTGCAGGAAGTGTGGAAAACTACATGGAGG
AGGGTGTGTGATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963439
Expected error %
0.0339121
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0065M23
Clone
Clone name
hba-65m23
LE_HBa0065M23
C03HBa0065M23
P065M23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found