Clone Read LE_HBa0065M23_T7_50157

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0065M23_T7_50157
Primer
T7
ID from Seq. Facility
LE_HBa_065_M23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
591 trimmed for vector and quality, 810 raw
Sequence
>LE_HBa0065M23_T7_50157 (raw untrimmed)
CTGAACTCTGGACCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTACGTTAATTTAATTGTGAGGTTGCATGGGGTTCCTTTGTACATCAT
CTTATAGATGTCCTTAGTTGATCTCTCATTTATGGAAGTAATTTCCGAAGGGTCTTGGTACTCAGGTTAACCTTAGCATAATATTTCATCTGCAAATAGA
TGGACAGGCAGAGCGTACCATTCAAACCCTAGAGGACATATTTATAGCTTGTGTTATCGATTTCAAGGCTAATTGAGATGATAACCTTACTCTTATTCAA
TTCTACTACAATAATAGCTACCCTTCTTTGAGGCACTGTATCGGTGTGGATGTACATCTCATGTTGGTTGTTTTGAATTAGGTGAAGGAGTTGTGATATA
ATCTAATTTAGTCCATTATGCTGCAGAGAAAGTGCAACTCATTAAAGATAGACTTAAGATAGGCCAGAATCGTAATGAATCTTATGCAGATGTAAGGACA
AGGGAACTAGATTTCCAAGTCCATGATTAAGTTTTCCTGAAAGTGTCACCTATGATGGAGGTGATGAGGTTTGGCAATAAAGAGAATCTCAATACTATAT
ATGTAGGCGCTTTCAAGATCCTGTGAAGGGTTGGGAAAAGTTGATATGGTTTATAATTTGCCACTAGGTTACCAGGCATGGATCCAATTTTAAATATAAA
CTTTGAAAAAAATTATGGGTTTTCCAGCTATATGGAGCAGTAAAAATGTGAGGTGAGAAAAAAAAAAAAGATAAATGAAGATAACAAGAATCAGAAAGTT
ACAAAAAAGG
>LE_HBa0065M23_T7_50157 (trimmed for quality and cloning vector)
AGCTTTACGTTAATTTAATTGTGAGGTTGCATGGGGTTCCTTTGTACATCATCTTATAGATGTCCTTAGTTGATCTCTCATTTATGGAAGTAATTTCCGA
AGGGTCTTGGTACTCAGGTTAACCTTAGCATAATATTTCATCTGCAAATAGATGGACAGGCAGAGCGTACCATTCAAACCCTAGAGGACATATTTATAGC
TTGTGTTATCGATTTCAAGGCTAATTGAGATGATAACCTTACTCTTATTCAATTCTACTACAATAATAGCTACCCTTCTTTGAGGCACTGTATCGGTGTG
GATGTACATCTCATGTTGGTTGTTTTGAATTAGGTGAAGGAGTTGTGATATAATCTAATTTAGTCCATTATGCTGCAGAGAAAGTGCAACTCATTAAAGA
TAGACTTAAGATAGGCCAGAATCGTAATGAATCTTATGCAGATGTAAGGACAAGGGAACTAGATTTCCAAGTCCATGATTAAGTTTTCCTGAAAGTGTCA
CCTATGATGGAGGTGATGAGGTTTGGCAATAAAGAGAATCTCAATACTATATATGTAGGCGCTTTCAAGATCCTGTGAAGGGTTGGGAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.95487
Expected error %
0.824383
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39297.1| Score 108 E Value 3e-44 Identity 53.40% Align. Length 511bp (86.46%) Frame 2
putative gag-pol protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 108 E Value 1e-41 Identity 53.40% Align. Length 487bp (82.40%) Frame 2
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0065M23
Clone
Clone name
hba-65m23
LE_HBa0065M23
C03HBa0065M23
P065M23
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found