Clone Read LE_HBa0065N03_T7_50165

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0065N03_T7_50165
Primer
T7
ID from Seq. Facility
LE_HBa_065_N03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
697 trimmed for vector and quality, 881 raw
Sequence
>LE_HBa0065N03_T7_50165 (raw untrimmed)
TTTGCTTCGGCCCCGGCGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTAGAAATCTATTTGCATAGCAATATCTAGTGTGTGTTAAAAAACTCA
TTCTTTTTTCAGCGCTCTATTCTGTCGGAAAGAAAGCATAAACCTCACAATGCTTTGTCATAATATTAACAAAAAGATTCAAAACACATGGCTCTTACAT
TATACTTAGAAACTGGATTATATGAGGTCTGTTATCCAGATGAACAAAATGATACAATCTTTTATGCTTGGCGAGCGCACTTTTGACATCCCACCCCTGC
ACGTTTCTATTGTGCCACATAATTACTGTGCGCATCAAAATTGTTCTAAGCACTTTCATCACCGTCTAGCGCTCCCATACCCTGTACGTCCAAGATTATA
ACCCCCCAAAAGAGACGGGGTGGAGCGGGTGAGAGGGTTGAATATGATGAAACCTATGAAATAAAGAAATAATTTGCAAGAAAAGTTATGTCACATCCGG
GAAGTACCCCCTAGATGCAACCAGCGTCGTCTTCCTCAAAGAGGACTAAGACTACCCTCTTAGCATTCGTCATTACATTCATAGGTCTAAAGACGCAGAA
AATTTAAAATTTTTCCTCTACACTATTCCATGAGGTTTACTTTAAACCTCTCGCTTACATATCATACATCCATATCCAGTATAAATAGACCCCTTCGTCA
AAAACAATGCCATATTTTTCTACTTTTATGGAACACCACACACCACTCACCCTACATACTACATACACACATCCATACCTACCACACATTATCAATCGAC
TTACAACACCTATATCTCTCAAACCGATCATTTTATTCAACCTCTCATTATCATATTAAATTGCTCATACCCATAACTCTT
>LE_HBa0065N03_T7_50165 (trimmed for quality and cloning vector)
AGCTTTAGAAATCTATTTGCATAGCAATATCTAGTGTGTGTTAAAAAACTCATTCTTTTTTCAGCGCTCTATTCTGTCGGAAAGAAAGCATAAACCTCAC
AATGCTTTGTCATAATATTAACAAAAAGATTCAAAACACATGGCTCTTACATTATACTTAGAAACTGGATTATATGAGGTCTGTTATCCAGATGAACAAA
ATGATACAATCTTTTATGCTTGGCGAGCGCACTTTTGACATCCCACCCCTGCACGTTTCTATTGTGCCACATAATTACTGTGCGCATCAAAATTGTTCTA
AGCACTTTCATCACCGTCTAGCGCTCCCATACCCTGTACGTCCAAGATTATAACCCCCCAAAAGAGACGGGGTGGAGCGGGTGAGAGGGTTGAATATGAT
GAAACCTATGAAATAAAGAAATAATTTGCAAGAAAAGTTATGTCACATCCGGGAAGTACCCCCTAGATGCAACCAGCGTCGTCTTCCTCAAAGAGGACTA
AGACTACCCTCTTAGCATTCGTCATTACATTCATAGGTCTAAAGACGCAGAAAATTTAAAATTTTTCCTCTACACTATTCCATGAGGTTTACTTTAAACC
TCTCGCTTACATATCATACATCCATATCCAGTATAAATAGACCCCTTCGTCAAAAACAATGCCATATTTTTCTACTTTTATGGAACACCACACACCA

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.966549
Expected error %
4.65748
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0065N03
Clone
Clone name
hba-65n3
LE_HBa0065N03
P065N03
Clone type
BAC
Contamination
none
Estimated length
123,229
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found