Clone Read LE_HBa0065O02_SP6_50210

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0065O02_SP6_50210
Primer
SP6
ID from Seq. Facility
LE_HBa_065_O02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
711 trimmed for vector and quality, 862 raw
Sequence
>LE_HBa0065O02_SP6_50210 (raw untrimmed)
AAAAAAAAATGTTTTTCGTTNACCTAGTAGTGGATGCNTTGAAGGGAATAGTAAAAGCTACCTATTTGATCTTTAACTTGCAAAATGTATGTGAAATTCT
TCCCTGGTGGAATTGGACATGTTGTTCCCCATACTCCATCTTCAAATGAGTTTCTCCTATTTTGTATTCCATTCCTATAAGTAATTTCGAAACGTATTAA
GTAACAGCTCGTGTCTGACTAATTAATATCACAGAATCATAGATGTCGTCACGACAGAATAAGTAGAGACTAAATAATAGTATATGGTATTTTTGCATTT
TTTGGTATGTCATTGTCTACTCATGCTTAACGAACTAACTTCAAGCCTCGATTCATTCTCTGCGAAAAGGAATGAGTTGATTCGCGATTTGTGCTCATGA
ACCAAGGTTTCTTTAAGTGTTTATCGAGAAAAGCTACTTTTTTAGGTTTTATTAAGATAATTTTTGTTACTATTCAAAAACACTTATCTTTTTCTAAAAA
GTCTGACTTCAATATTCTCTAAAATAATATTATAAACATTGTTAGTGCTATTATTTAAATTCAAAATTAAATATTTGTGTAGTGAAAATGTGGACATATT
TTGCTTTTTTACTTGTGTTGTTCACATGCACTTCACATGATTACCTACTCTTTGTCTAGTTTTTTTTTCTTCAAAATATATACACTCGTACAAGTTATAT
CATGTGACTTGCACAAATTATAAATAATTCAAAATATTGTTCAACTTTTCCTACATTTGATCAATACAATATTCTTGAATCTTGATTACATCGATATCGA
TGCTAGTTATAATTCCAAAATAAGTTGGAAAATGACTTAAATTTGTCAAAAACGAATTAAAA
>LE_HBa0065O02_SP6_50210 (trimmed for quality and cloning vector)
ATAGTAAAAGCTACCTATTTGATCTTTAACTTGCAAAATGTATGTGAAATTCTTCCCTGGTGGAATTGGACATGTTGTTCCCCATACTCCATCTTCAAAT
GAGTTTCTCCTATTTTGTATTCCATTCCTATAAGTAATTTCGAAACGTATTAAGTAACAGCTCGTGTCTGACTAATTAATATCACAGAATCATAGATGTC
GTCACGACAGAATAAGTAGAGACTAAATAATAGTATATGGTATTTTTGCATTTTTTGGTATGTCATTGTCTACTCATGCTTAACGAACTAACTTCAAGCC
TCGATTCATTCTCTGCGAAAAGGAATGAGTTGATTCGCGATTTGTGCTCATGAACCAAGGTTTCTTTAAGTGTTTATCGAGAAAAGCTACTTTTTTAGGT
TTTATTAAGATAATTTTTGTTACTATTCAAAAACACTTATCTTTTTCTAAAAAGTCTGACTTCAATATTCTCTAAAATAATATTATAAACATTGTTAGTG
CTATTATTTAAATTCAAAATTAAATATTTGTGTAGTGAAAATGTGGACATATTTTGCTTTTTTACTTGTGTTGTTCACATGCACTTCACATGATTACCTA
CTCTTTGTCTAGTTTTTTTTTCTTCAAAATATATACACTCGTACAAGTTATATCATGTGACTTGCACAAATTATAAATAATTCAAAATATTGTTCAACTT
TTCCTACATTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.925048
Expected error %
0.0366145
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g76160.1 Score 85 E Value 3e-17 Identity 29.40% Align. Length 125bp (17.58%) Frame 2
68414.m08844 multi-copper oxidase type I family protein similar to pollen-specific BP10 protein [SP|Q00624][Brassica napus]; contains Pfam profile: PF00394 Multicopper oxidase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g22010.1 Score 82 E Value 2e-16 Identity 27.00% Align. Length 125bp (17.58%) Frame 2
68417.m03185 multi-copper oxidase type I family protein similar to pollen-specific BP10 protein [SP|Q00624][Brassica napus]; contains Pfam profile: PF00394 Multicopper oxidase
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA65634.1| Score 89 E Value 1e-16 Identity 30.20% Align. Length 125bp (17.58%) Frame 2
PS60 [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN15546.1| Score 85 E Value 2e-15 Identity 29.40% Align. Length 125bp (17.58%) Frame 2
pectinesterase, putative [Arabidopsis thaliana] gb|AAM97070.1| pectinesterase, putative [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0065O02
Clone
Clone name
hba-65o2
LE_HBa0065O02
C12HBa0065O02
P065O02
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found