Clone Read LE_HBa0065O02_T7_50211

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0065O02_T7_50211
Primer
T7
ID from Seq. Facility
LE_HBa_065_O02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
769 trimmed for vector and quality, 818 raw
Sequence
>LE_HBa0065O02_T7_50211 (raw untrimmed)
TTTGGCCTGGGTACCGCGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTATGCAACTGGTTGGATATAACATCTTATGGTTGTTCAAGTGCTGC
AGAATTTTATGTTCAGTTTGTGACTTTCTGTCATATCAATGTTGTTGATTTTTATTTTTGACTATTGCAAGATATTCTTGATATGTAAATGAGTGCAACT
AATTTTGGACTGAGTTATAGTTGTTGATTGATCATTGATTCATTAGAACCTCAAGATGCACCTAATTTGATTGGACAGAGAAGTAATGATTATAAATCCC
CAGTACAAAATCATATCTGGTGATAGCCAATCTGTCTGCATAATCATGCTCTGGGATTTGATGATTGCGCTATACTTATTTGCACTTTTAAGTAAATTGG
CTACAGAAGATACACTTAAAAATTACCAGCCCATGCTAACTATAGGTTGTCAAATACTCCTCTATACGTAACATGATTCTGATAATTCCATCTATTTTTT
TCTAATGTATGGCCCTTTGAGTTGGCACTCCTTTCTGTTACCACCCGTGTACTTTAGCTTTCTGCTGGAACCAAAATATAAGACTGTGAAGCGTGGAACC
TTCTATAGTTAACGGTGTAAGCTGGTCCATCTTTATGGCAGATAACTGATGCTGTTGTTGCTGCTCGCATTTTAAATGCCACTCTTGTTGTTCCAAAGTT
GGACAAGACGTCTTTCTGGAAAGATTCTAGGTGAGTGAGTAGTATCAGAAGAATGATTTAGTATTTTCTTGCATATTGGTTTCTCCAACCATCACTCAAC
TTATTATTGTGTAGGTAC
>LE_HBa0065O02_T7_50211 (trimmed for quality and cloning vector)
AGCTTTATGCAACTGGTTGGATATAACATCTTATGGTTGTTCAAGTGCTGCAGAATTTTATGTTCAGTTTGTGACTTTCTGTCATATCAATGTTGTTGAT
TTTTATTTTTGACTATTGCAAGATATTCTTGATATGTAAATGAGTGCAACTAATTTTGGACTGAGTTATAGTTGTTGATTGATCATTGATTCATTAGAAC
CTCAAGATGCACCTAATTTGATTGGACAGAGAAGTAATGATTATAAATCCCCAGTACAAAATCATATCTGGTGATAGCCAATCTGTCTGCATAATCATGC
TCTGGGATTTGATGATTGCGCTATACTTATTTGCACTTTTAAGTAAATTGGCTACAGAAGATACACTTAAAAATTACCAGCCCATGCTAACTATAGGTTG
TCAAATACTCCTCTATACGTAACATGATTCTGATAATTCCATCTATTTTTTTCTAATGTATGGCCCTTTGAGTTGGCACTCCTTTCTGTTACCACCCGTG
TACTTTAGCTTTCTGCTGGAACCAAAATATAAGACTGTGAAGCGTGGAACCTTCTATAGTTAACGGTGTAAGCTGGTCCATCTTTATGGCAGATAACTGA
TGCTGTTGTTGCTGCTCGCATTTTAAATGCCACTCTTGTTGTTCCAAAGTTGGACAAGACGTCTTTCTGGAAAGATTCTAGGTGAGTGAGTAGTATCAGA
AGAATGATTTAGTATTTTCTTGCATATTGGTTTCTCCAACCATCACTCAACTTATTATTGTGTAGGTAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.950045
Expected error %
0.204352
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0065O02
Clone
Clone name
hba-65o2
LE_HBa0065O02
C12HBa0065O02
P065O02
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found