Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

Clone Read LE_HBa0066F17_T7_50577

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0066F17_T7_50577
Primer
T7
ID from Seq. Facility
LE_HBa_066_F17-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
733 trimmed for vector and quality, 845 raw
Sequence
>LE_HBa0066F17_T7_50577 (raw untrimmed)
GTTGGTTCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGAATTGACAGGAAACTTGGAATTGATAGGACTGTTGGTAGAGACTATTGGC
AGACTGATCTTGAGGATATAGAGATCTTCTTGTTCTTTACCAATCACCTGAGGGCTCTTCACTGAAGGGCCCTGTAAAATCAAACAAGAGTTAGGGGTAA
AAAAGATGGACTTCTGAAGCTGCTTGCATAACTTGTGAATTGATATGAGATTGAATTTCAAATAGGGAATGCGTAGCACATTTTCTAAAAAAAAATGTGA
AGAGATTTTCCCAGAACCATTATGAGCCACTTTGACTTTGTGAGAATTTGGGAGAGTGAAAATTATAGATTTAGTAAGAAGTCCAATATTAATGAAAGAA
ATTTTATCAGAAGTTATATGCTCTGAAGCACCACTATCTAGTATCCAAGAACACTTATCAATTTTAAGTAAACTGGCATGAGTTCAATTTTAAGTAAACT
GGCATGAGTTTTAAGACATTTGGTCATACCTGAAGATATCATGTTGAAAGATGAATCTCCTTGATGCTTCTGATTCATCTTCGGCAAGAGCCCCAAAAGT
TGAGCAACATTCTCTGGAGAAAGATTGTTCACACTTACAGCATCTGAATTTCCCTGTTGTGAACTTTCCCCTGTATACGCATTTAAAACAGGAGATAGCA
ACTCGATGTATTGAAGAATATAATAACTATCCCGGTTGTAAATATAAAAATACAATATAACTTTTGTGAGAGTTTTTTCAAACCGAACAATCATTCCTAA
TGACCTATGGTGACAATTCCATTCGTTTTTCACCCCAAAATTGTC
>LE_HBa0066F17_T7_50577 (trimmed for quality and cloning vector)
AGCTTAGAATTGACAGGAAACTTGGAATTGATAGGACTGTTGGTAGAGACTATTGGCAGACTGATCTTGAGGATATAGAGATCTTCTTGTTCTTTACCAA
TCACCTGAGGGCTCTTCACTGAAGGGCCCTGTAAAATCAAACAAGAGTTAGGGGTAAAAAAGATGGACTTCTGAAGCTGCTTGCATAACTTGTGAATTGA
TATGAGATTGAATTTCAAATAGGGAATGCGTAGCACATTTTCTAAAAAAAAATGTGAAGAGATTTTCCCAGAACCATTATGAGCCACTTTGACTTTGTGA
GAATTTGGGAGAGTGAAAATTATAGATTTAGTAAGAAGTCCAATATTAATGAAAGAAATTTTATCAGAAGTTATATGCTCTGAAGCACCACTATCTAGTA
TCCAAGAACACTTATCAATTTTAAGTAAACTGGCATGAGTTCAATTTTAAGTAAACTGGCATGAGTTTTAAGACATTTGGTCATACCTGAAGATATCATG
TTGAAAGATGAATCTCCTTGATGCTTCTGATTCATCTTCGGCAAGAGCCCCAAAAGTTGAGCAACATTCTCTGGAGAAAGATTGTTCACACTTACAGCAT
CTGAATTTCCCTGTTGTGAACTTTCCCCTGTATACGCATTTAAAACAGGAGATAGCAACTCGATGTATTGAAGAATATAATAACTATCCCGGTTGTAAAT
ATAAAAATACAATATAACTTTTGTGAGAGTTTT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.950794
Expected error %
0.700887
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF79879.1| Score 77 E Value 5e-13 Identity 11.60% Align. Length 371bp (50.61%) Frame 1
T7N9.5 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB81200.1| Score 74 E Value 3e-12 Identity 12.60% Align. Length 389bp (53.07%) Frame 1
putative retrotransposon polyprotein [Arabidopsis thaliana] emb|CAB40067.1| putative retrotransposon polyprotein [Arabidopsis thaliana] pir||T04294 hypothetical protein F25I24.200 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0066F17
Clone
Clone name
hba-66f17
LE_HBa0066F17
P066F17
Clone type
BAC
Contamination
none
Estimated length
71,698
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found