Clone Read LE_HBa0066I13_T7_50713

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0066I13_T7_50713
Primer
T7
ID from Seq. Facility
LE_HBa_066_I13-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
321 trimmed for vector and quality, 887 raw
Sequence
>LE_HBa0066I13_T7_50713 (raw untrimmed)
CTTCCCTCTCGTGTTCGTTTCCGGGGGATCTCTAGAGTCTACCTGCAGGCATGCAAGCTTGTTGTGTAGCTATAATATTTCCTATCTGTTTCCTTCTTGA
TTTCTGCCTTGGTGGCCAATCTTGGGAAAATCTCAAAAGATATGATACACTTTGCCGGTTCATTCGGGGGTAAATTATGACCTCCCTGTGAGACATGAGA
GTCCAACAGAGCCACATCATGATGTATACTTGCTCTCGATTGGTAGAGCAGGACGTTTTGGACGCAAACGTACTTTGTTGTCACTTTCTTATGCATGCTT
CTCCTGATAGATTAATGGCTGAAAATGAGCCACATAGATATGTTGTGATCTTTCTCTTACCTATTCCTCGTGTTTGAGCACGTGCGATATTTCACTCTGC
GCGCTTTGACTAATACAACGTTCTGATCGTAAATATTGCGACTAATTTTCCTTCATTCGATGGACTAGACTTGTATTTATCTGTCTGTCGTCTCTGACTA
CTGCCCTTTCCCTTCATATTTCAATCTACTTCCATTCATCTCTTTCTCCTTGTCCCTAGTCTCCCCCGCCTAGTCTCGTTGGGTATTTTTCGCCGCTTGT
GCCTTTCTGCTCTTCCTCCCCCTCTTTGCTTCCCCACTTAGCTCCCTCATCTAATTCTTTTATCACGCATTCTGTTGTACTTAAACGATCCCTTCCCTAC
CTCCACCCATAGCATCTTTCTCTCCATCTTATGATATCCATCCTACCTTTTTTTCACACCTCCTTTTTCTTTCATTAATTCACGCTCATATCTCCCTATA
CTTTTTTTACTGCTTTGACTGAGCCTATATTATATTTTATGCGCTTCTTCGTCCCCTAATCCTACATCATCCTCTCTCTCTTCCTGC
>LE_HBa0066I13_T7_50713 (trimmed for quality and cloning vector)
AGCTTGTTGTGTAGCTATAATATTTCCTATCTGTTTCCTTCTTGATTTCTGCCTTGGTGGCCAATCTTGGGAAAATCTCAAAAGATATGATACACTTTGC
CGGTTCATTCGGGGGTAAATTATGACCTCCCTGTGAGACATGAGAGTCCAACAGAGCCACATCATGATGTATACTTGCTCTCGATTGGTAGAGCAGGACG
TTTTGGACGCAAACGTACTTTGTTGTCACTTTCTTATGCATGCTTCTCCTGATAGATTAATGGCTGAAAATGAGCCACATAGATATGTTGTGATCTTTCT
CTTACCTATTCCTCGTGTTTG

This is probably not a useful sequence.

Problems:
  • High predicted error rate
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.964937
Expected error %
4.88222
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0066I13
Clone
Clone name
hba-66i13
LE_HBa0066I13
P066I13
Clone type
BAC
Contamination
none
Estimated length
100,956
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found