Clone Read LE_HBa0010K15_SP6_5116

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0010K15_SP6_5116
Primer
SP6
ID from Seq. Facility
LE_HBa_010_K15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
409 trimmed for vector and quality, 965 raw
Genbank Accession
Sequence
>LE_HBa0010K15_SP6_5116 (raw untrimmed)
TCCCAAAAAACCTACTGCAAAAGCCCTTGAAGAACTACATTGTGAATGTTCCTTTAAAGAGAAGGAANANNNNNNNANNNANAGAGANNNACCCTTTGGG
GGANAAGAAAAAGGAANAGANAANNNAAAANNNNNNNGAAAAAGGAAAAGANANNAAGGGAGAGAAANGAAGANAAAAAAAAGAGAAGAAANCANCNNGG
NAGGAAGAAGTTGAGAGAAAAAAAAAGAGGGGAGANNGAGAAAAAAAGAAAAAGAAGAAGAATCCCCTCTCCAAAAGCGACATGGCAAAAGANAN
GTCTC
AACATAGAGAACCTCTCTGAAACAATTTCTCCAACAAAATCTTCATTACTGTCAAAAAGATTTCGGCTAGAACTACACCCGTCAAGATGAACACCTCTTT
CTAACCTGATTCAATAATCGATTATCGAACCACTGAACCTGACTTCATCATTGAACCTGGCTCTGATACCACTTGTTAGGACCGTAAATAAGCATGTGTA
AATGCGGAAGCTAGCAAAGCAAACCTCGAAAGCCCACGAGTAAGAAGACAACGAGAAATATACCAAAAGACTCAAAGATTTAACGTGGTTCGGTCAGTCG
ACCTACGTCCACAAAGGAGATGAGCAATCCACTATAAATATGAGAGTACAAAATACAGAGGGAAACAACCTCAACCAATTTACTCGGAATACATGGGAGG
TTCACACAAGTGATAACGTATTGAGCTTGTGAACCATAATTCTCCCCCTAACCAAAACTCTCAAAGCCCTTAAACTACATTGTGAATGCTGATTAAGTTA
GAAAGAATTCCCTCCTATTATAAAGTCTAAACCTTTCCCTCCCAAAAAAGGATTAGTCATCCAAACTTTTTCTAAAGGAAAACTATTTTGGGAAAAATAG
GAAAATAAAAAAACAAAACCTCCTCCGGCGAATGCAACGAAAATAATTAACAAAACTTAAAAAAN
>LE_HBa0010K15_SP6_5116 (trimmed for quality and cloning vector)
GTCTCAACATAGAGAACCTCTCTGAAACAATTTCTCCAACAAAATCTTCATTACTGTCAAAAAGATTTCGGCTAGAACTACACCCGTCAAGATGAACACC
TCTTTCTAACCTGATTCAATAATCGATTATCGAACCACTGAACCTGACTTCATCATTGAACCTGGCTCTGATACCACTTGTTAGGACCGTAAATAAGCAT
GTGTAAATGCGGAAGCTAGCAAAGCAAACCTCGAAAGCCCACGAGTAAGAAGACAACGAGAAATATACCAAAAGACTCAAAGATTTAACGTGGTTCGGTC
AGTCGACCTACGTCCACAAAGGAGATGAGCAATCCACTATAAATATGAGAGTACAAAATACAGAGGGAAACAACCTCAACCAATTTACTCGGAATACATG
GGAGGTTCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951604
Expected error %
0.34344
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0010K15
Clone
Clone name
hba-10k15
LE_HBa0010K15
P010K15
Clone type
BAC
Contamination
none
Estimated length
131,956
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found