Clone Read LE_HBa0067D16_SP6_51246

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0067D16_SP6_51246
Primer
SP6
ID from Seq. Facility
LE_HBa_067_D16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
739 trimmed for vector and quality, 770 raw
Sequence
>LE_HBa0067D16_SP6_51246 (raw untrimmed)
AAGAGGGGTGCCGGCCACTAGTGAGGATGTTCATTACTTTCATGCGCATGTGAAGTTATTGAATGAGTATTAAGTTGTTTCTTGTTTAGCATTTGAAAAT
GCTCTGTTCTAATTCATGATCTCAGGATGCTGGTTTACGAGTATGTCAACAATGGCAATTTGGAACAGTGGCTTCATGGAGCTATGCGACACCACGGGTA
TCTCACTTGGGAGGCTAGGATGAAGGTTCTCCTTGGGACAGCTAAAGCGTAAGCTCATTCAGCTAAATGCTTAAATCTATTTTGGAATAATACAGATCTC
TTGATGTGCTATCTTTTCTTGCAGTCTTGCGTATTTGCATGAGAATATTGAGCCCAAAGTTGTTCATCGAGACATAAAATCAAGTAATATATTGATTGAT
GATGACTTCAATGCGAAGGTCTCTGATTTTGGTCTGGCCAAACTGCTTGGTGCTGGTAAAAGTCATATCACAACTCGAGTCATGGGTACCTTTGGGTTAG
TTTCTTTCTTCTGCTCCTTTTGATTCCATTCCGACTTGCTTCACGTTCTGGTCTTCTAGACTTTACAATCTTCAACTTCTGGTGTCATGTTTTATTACTC
TTAAGATATAAAAAGTTGAAACAGAAGTTAAGCAGTATTGTATGATTTCACACCATTACAAATATTTGACAGGTATGTGGCTCCTGAATATGCAAATACT
GGTCTCTTGAATGAAAAGAGTGATGTTTATAGCTTTGGGGTAGTGTTGTTAGAATCGATCACAGGAAGAG
>LE_HBa0067D16_SP6_51246 (trimmed for quality and cloning vector)
TCATTACTTTCATGCGCATGTGAAGTTATTGAATGAGTATTAAGTTGTTTCTTGTTTAGCATTTGAAAATGCTCTGTTCTAATTCATGATCTCAGGATGC
TGGTTTACGAGTATGTCAACAATGGCAATTTGGAACAGTGGCTTCATGGAGCTATGCGACACCACGGGTATCTCACTTGGGAGGCTAGGATGAAGGTTCT
CCTTGGGACAGCTAAAGCGTAAGCTCATTCAGCTAAATGCTTAAATCTATTTTGGAATAATACAGATCTCTTGATGTGCTATCTTTTCTTGCAGTCTTGC
GTATTTGCATGAGAATATTGAGCCCAAAGTTGTTCATCGAGACATAAAATCAAGTAATATATTGATTGATGATGACTTCAATGCGAAGGTCTCTGATTTT
GGTCTGGCCAAACTGCTTGGTGCTGGTAAAAGTCATATCACAACTCGAGTCATGGGTACCTTTGGGTTAGTTTCTTTCTTCTGCTCCTTTTGATTCCATT
CCGACTTGCTTCACGTTCTGGTCTTCTAGACTTTACAATCTTCAACTTCTGGTGTCATGTTTTATTACTCTTAAGATATAAAAAGTTGAAACAGAAGTTA
AGCAGTATTGTATGATTTCACACCATTACAAATATTTGACAGGTATGTGGCTCCTGAATATGCAAATACTGGTCTCTTGAATGAAAAGAGTGATGTTTAT
AGCTTTGGGGTAGTGTTGTTAGAATCGATCACAGGAAGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958055
Expected error %
0.0253276
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g56720.2 Score 112 E Value 3e-45 Identity 89.50% Align. Length 645bp (87.28%) Frame 2
68414.m06524 protein kinase family protein contains protein kinase domain, Pfam:PF00069
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g56720.1 Score 112 E Value 3e-45 Identity 89.50% Align. Length 645bp (87.28%) Frame 2
68414.m06523 protein kinase family protein contains protein kinase domain, Pfam:PF00069
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_908679.1| Score 113 E Value 1e-42 Identity 90.20% Align. Length 381bp (51.56%) Frame 2
Putative protein kinase [Oryza sativa (japonica cultivar-group)] dbj|BAB21240.1| receptor protein kinase PERK1-like protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAP37681.1| Score 112 E Value 1e-43 Identity 87.30% Align. Length 381bp (51.56%) Frame 2
At1g56720 [Arabidopsis thaliana] ref|NP_974041.1| protein kinase family protein [Arabidopsis thaliana] ref|NP_564722.1| protein kinase family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0067D16
Clone
Clone name
hba-67d16
LE_HBa0067D16
P067D16
Clone type
BAC
Contamination
none
Estimated length
77,539
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found