Clone Read LE_HBa0067E11_T7_51285

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0067E11_T7_51285
Primer
T7
ID from Seq. Facility
LE_HBa_067_E11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
739 trimmed for vector and quality, 817 raw
Sequence
>LE_HBa0067E11_T7_51285 (raw untrimmed)
CTGGGTCCCCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCAATTTCATCAGTCATTAGAGGTGACAGTTATATAAGGATGCCTATTTCAAG
ACTTATTACAGATAAGGTTTCTATAAAACTGTTTCTCATTAAGTAGCTGAGGTAGTAGTTCACATGAACAGATTCTGAGGTTATGCATAAGTTTAAACCA
AACAGGAAGATTGATCAGATAAGACCTTTAGACGTTCCTAAACATAGCTTTTGTCTTGAAACAGAGGTTCAGAAGAAGACTAAATAGTTGCAAATTTGCT
GGAAGACTAATAAGTGGAACTTACTCCATTGTCTGTATAAAGGTGGAACAGGAGTTCAGGAGATGACCCTCATGAGCTCTTAAGCTATTAAGGGTGCCAG
AGAGTATGACTCCCTCAAGTAGCTCTTCTGATTTCTGAAATGTATCAGTGCACAGATTTCAAATCAGAGTAACTTAAATATTTTCAGAAGATCAGTTGTT
GATCCTATGATCATCCACTGCACTAACTTTAGTTTGCTGATGCAAGTTACTTGGGTCATATTTCAATTTAATAAAATTGGAGCCTATTCAATTGCACAAG
AAACATAATTGAACTGGATACCTTTTGTAATTCTCCATTTACTCGGAAATCTCCATCAAATGGGACAATTTTGCAGACATTTTCGCCAACCTTAAATGCC
TCCCCAAATGTGCCTTCTCCAACCTTGGCAATTGTTTGCGTCTCACTGAGTACAATTTTGCAAAATTGGATGCTTAGAGAAGTTAAGATTAAGAGCAAGA
TCAAACTGAATTAAGTC
>LE_HBa0067E11_T7_51285 (trimmed for quality and cloning vector)
AGCTTCAATTTCATCAGTCATTAGAGGTGACAGTTATATAAGGATGCCTATTTCAAGACTTATTACAGATAAGGTTTCTATAAAACTGTTTCTCATTAAG
TAGCTGAGGTAGTAGTTCACATGAACAGATTCTGAGGTTATGCATAAGTTTAAACCAAACAGGAAGATTGATCAGATAAGACCTTTAGACGTTCCTAAAC
ATAGCTTTTGTCTTGAAACAGAGGTTCAGAAGAAGACTAAATAGTTGCAAATTTGCTGGAAGACTAATAAGTGGAACTTACTCCATTGTCTGTATAAAGG
TGGAACAGGAGTTCAGGAGATGACCCTCATGAGCTCTTAAGCTATTAAGGGTGCCAGAGAGTATGACTCCCTCAAGTAGCTCTTCTGATTTCTGAAATGT
ATCAGTGCACAGATTTCAAATCAGAGTAACTTAAATATTTTCAGAAGATCAGTTGTTGATCCTATGATCATCCACTGCACTAACTTTAGTTTGCTGATGC
AAGTTACTTGGGTCATATTTCAATTTAATAAAATTGGAGCCTATTCAATTGCACAAGAAACATAATTGAACTGGATACCTTTTGTAATTCTCCATTTACT
CGGAAATCTCCATCAAATGGGACAATTTTGCAGACATTTTCGCCAACCTTAAATGCCTCCCCAAATGTGCCTTCTCCAACCTTGGCAATTGTTTGCGTCT
CACTGAGTACAATTTTGCAAAATTGGATGCTTAGAGAAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.960695
Expected error %
0.378895
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g09450.1 Score 70 E Value 1e-12 Identity 20.60% Align. Length 140bp (18.94%) Frame 1
68414.m01057 haspin-related similar to haspin (GI:9229937) {Mus musculus} and haploid germ cell-specific nuclear protein kinase (GI:13561418) {Mus musculus}
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC33205.1| Score 70 E Value 6e-11 Identity 20.60% Align. Length 140bp (18.94%) Frame 1
Hypothetical protein [Arabidopsis thaliana] ref|NP_172416.2| haspin-related [Arabidopsis thaliana] pir||H86227 hypothetical protein [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO41970.1| Score 70 E Value 6e-11 Identity 20.60% Align. Length 140bp (18.94%) Frame 1
unknown protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0067E11
Clone
Clone name
hba-67e11
LE_HBa0067E11
P067E11
Clone type
BAC
Contamination
none
Estimated length
97,107
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found