Clone Read LE_HBa0002C08_SP6_52718

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0002C08_SP6_52718
Primer
SP6
ID from Seq. Facility
LE_HBa_002_C08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
735 trimmed for vector and quality, 796 raw
Sequence
>LE_HBa0002C08_SP6_52718 (raw untrimmed)
CTTTTTCCGTTAAATGCTCCTCTTTGTGGGATACTATGAACACTGAATATCACACCCACATTTGGGCAAATGGGCATTTCTTCTAGGAGAAGCAGAAACA
AGAAAAAAGGAAAGGAAAGTTCAAGTACGTATTATATCTCCGTTGATTGTTTCCCGGCTGAGGCCGTAGAATTCTTTTTCCCTTTCCTCTTTCAACTGTT
ATTCTTCCTTTTTTGGTAGGTAGAATGAGGTTTATACGTGAATGTTGGTGCAGAGATATGAGAGTTCTCTGGTCTATGAGATGAAATAAAATGAATCCCC
GATGCTGGTGGTGAATGGTGTTGTCTTGCAGCAGAGATGGTGATCGTATGAGACCGCTGGTGTAGGCTGTTTTTTTTAGGTGAACAGTAGAAAAGTTTGT
TTTTAATGACAATGAGGCTTGGGAGATGGAAAAATATGTGGTAACCAAACTAGTCCAACCCTATACATTATGGATGATTTGATCATTTTCTCGTTTTTTT
TTTATAGTGGTGGGCGAAATGGGAGCTGCCTAAACCGTGAAACAGGGTCGTGGTAGAGCAATACAAGCTTTGTGACTTATTCTTGCTGCCGTCGGCATAA
ATCTGACCCGCTTTTCGCTCTTCCGGGACTGGTACAGACATAGGTGTTTTTTCTACGGCTCTAGGCCTTCTCTAGGCTAGTAGAGTTCTTTTGCTACTCT
CCCAGTAGAATTAATTTTCCTTATTTCCTGGAGGAGGGCCTCCTTCCTCTCTTCCTCGGACTGCGAATGCTATTCCTCTTTCTTGCTATCGAAATC
>LE_HBa0002C08_SP6_52718 (trimmed for quality and cloning vector)
TGCTCCTCTTTGTGGGATACTATGAACACTGAATATCACACCCACATTTGGGCAAATGGGCATTTCTTCTAGGAGAAGCAGAAACAAGAAAAAAGGAAAG
GAAAGTTCAAGTACGTATTATATCTCCGTTGATTGTTTCCCGGCTGAGGCCGTAGAATTCTTTTTCCCTTTCCTCTTTCAACTGTTATTCTTCCTTTTTT
GGTAGGTAGAATGAGGTTTATACGTGAATGTTGGTGCAGAGATATGAGAGTTCTCTGGTCTATGAGATGAAATAAAATGAATCCCCGATGCTGGTGGTGA
ATGGTGTTGTCTTGCAGCAGAGATGGTGATCGTATGAGACCGCTGGTGTAGGCTGTTTTTTTTAGGTGAACAGTAGAAAAGTTTGTTTTTAATGACAATG
AGGCTTGGGAGATGGAAAAATATGTGGTAACCAAACTAGTCCAACCCTATACATTATGGATGATTTGATCATTTTCTCGTTTTTTTTTTATAGTGGTGGG
CGAAATGGGAGCTGCCTAAACCGTGAAACAGGGTCGTGGTAGAGCAATACAAGCTTTGTGACTTATTCTTGCTGCCGTCGGCATAAATCTGACCCGCTTT
TCGCTCTTCCGGGACTGGTACAGACATAGGTGTTTTTTCTACGGCTCTAGGCCTTCTCTAGGCTAGTAGAGTTCTTTTGCTACTCTCCCAGTAGAATTAA
TTTTCCTTATTTCCTGGAGGAGGGCCTCCTTCCTC

This is probably not a useful sequence.

Problems:
  • Probable foreign DNA contamination
Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.970735
Expected error %
0.209604
Sequence Annotations 
Automatic Annotations
Nicotiana tabacum Chloroplast (screening/organelle/nicotiana_tabacum_chloroplast)NCBI BLAST
gi|11465934|ref|NC_001879.1| Score 64 E Value 6e-12 Identity 92.70% Align. Length 54bp (7.35%) Frame 3
Nicotiana tabacum plastid, complete genome
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0002C08
Clone
Clone name
hba-2c8
LE_HBa0002C08
P002C08
Clone type
BAC
Contamination
none
Estimated length
71,162
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found