Clone Read LE_HBa0002C08_T7_52719

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0002C08_T7_52719
Primer
T7
ID from Seq. Facility
LE_HBa_002_C08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
760 trimmed for vector and quality, 804 raw
Genbank Accession
Sequence
>LE_HBa0002C08_T7_52719 (raw untrimmed)
GACTCGGTACCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCGAATTGCATGTGCAATGGAAGGCTCGAGATATCGCCATGCAAGAACTTG
GAACTCGAGTCGATTCATAGCGATGAAGTACTTGCAATGGTTAAGGAAATACGATGGGAACACAAGAACAAGTCGAATGTGAAAGATAATTTGGGAGTCA
CTCAGATCAAAAAGGATTATATTCGTTATGTGTATGGTTCTTCGATGTTGTATGGATACTTCTTAAAGTCCGCTTCGTTGAGATACCATTTGGAAAAGAG
TTTTGATACAACTAATTCTAACAACCTCTCATTTTCAAGTTCATGTCACTTGAAACAAAAGAGTGTTCCCATCGAGGGGAAGAAGTATGACAATTTGAAG
TCTTACGTCGAGAAATTTGATAATCAAACAATGAAAATGTGTAGAAAACCAAAATTCAACGTGACGATGAGTCTGATGGAGAAGCATTACTCTGCTCTTT
TTGGCGATGAGAATCAACATGAGGAAGTTTCAACGTCATTCACGAGTCTAAAGAGGTTTGTGTTGGAGGCTGTTCCTTTGGGAGGCAGAATTTCACTTTA
GGAAATTTTATCGACTTGAAGAGTATAGATCTCGTTATTATTAACCTAACGAGGAAGTTCACACTCGACTAGTTTCACTATGTAAGTAAGGGGGGAAATG
TGTTTTTCTCGATACTACATTGTGCTTCTGTGTCCCGTTAAATAGATAGAAAGAGTCTCTACGTTATAGTAATTGTCAAGTATAATAATTTTACTATTAC
TGAA
>LE_HBa0002C08_T7_52719 (trimmed for quality and cloning vector)
AGCTTTCGAATTGCATGTGCAATGGAAGGCTCGAGATATCGCCATGCAAGAACTTGGAACTCGAGTCGATTCATAGCGATGAAGTACTTGCAATGGTTAA
GGAAATACGATGGGAACACAAGAACAAGTCGAATGTGAAAGATAATTTGGGAGTCACTCAGATCAAAAAGGATTATATTCGTTATGTGTATGGTTCTTCG
ATGTTGTATGGATACTTCTTAAAGTCCGCTTCGTTGAGATACCATTTGGAAAAGAGTTTTGATACAACTAATTCTAACAACCTCTCATTTTCAAGTTCAT
GTCACTTGAAACAAAAGAGTGTTCCCATCGAGGGGAAGAAGTATGACAATTTGAAGTCTTACGTCGAGAAATTTGATAATCAAACAATGAAAATGTGTAG
AAAACCAAAATTCAACGTGACGATGAGTCTGATGGAGAAGCATTACTCTGCTCTTTTTGGCGATGAGAATCAACATGAGGAAGTTTCAACGTCATTCACG
AGTCTAAAGAGGTTTGTGTTGGAGGCTGTTCCTTTGGGAGGCAGAATTTCACTTTAGGAAATTTTATCGACTTGAAGAGTATAGATCTCGTTATTATTAA
CCTAACGAGGAAGTTCACACTCGACTAGTTTCACTATGTAAGTAAGGGGGGAAATGTGTTTTTCTCGATACTACATTGTGCTTCTGTGTCCCGTTAAATA
GATAGAAAGAGTCTCTACGTTATAGTAATTGTCAAGTATAATAATTTTACTATTACTGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.961008
Expected error %
0.439695
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g07310.1 Score 127 E Value 5e-30 Identity 14.90% Align. Length 536bp (70.53%) Frame 1
68416.m00871 expressed protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g48590.1 Score 126 E Value 1e-29 Identity 14.70% Align. Length 536bp (70.53%) Frame 1
68418.m06010 expressed protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAF02142.1| Score 127 E Value 2e-28 Identity 14.90% Align. Length 536bp (70.53%) Frame 1
unknown protein [Arabidopsis thaliana] gb|AAF20215.1| unknown protein [Arabidopsis thaliana] gb|AAM65166.1| unknown [Arabidopsis thaliana] gb|AAM91115.1| unknown protein [Arabidopsis thaliana] gb|AAK68821.1| Unknown protein [Arabidopsis thaliana] ref|NP_566302.1| expressed protein [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB10692.1| Score 126 E Value 7e-28 Identity 14.70% Align. Length 536bp (70.53%) Frame 1
unnamed protein product [Arabidopsis thaliana] gb|AAO63919.1| unknown protein [Arabidopsis thaliana] gb|AAO41921.1| unknown protein [Arabidopsis thaliana] ref|NP_199670.1| expressed protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0002C08
Clone
Clone name
hba-2c8
LE_HBa0002C08
P002C08
Clone type
BAC
Contamination
none
Estimated length
71,162
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found