Clone Read LE_HBa0002H14_SP6_52970

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0002H14_SP6_52970
Primer
SP6
ID from Seq. Facility
LE_HBa_002_H14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
684 trimmed for vector and quality, 739 raw
Genbank Accession
Sequence
>LE_HBa0002H14_SP6_52970 (raw untrimmed)
GCTTTGGGGAATTCTTCGCTTGATTCACTCTTCGGTGGAGGTAGGTTATGGTTATTTTCATGCTATTCGTAGTAAACTCTTAATAGTGAATGATATGTGT
TAGTAGTATTGTAAACCTTCTATATGCTTAATTGTATGCTTGCATGAATGATGTGATTATGTAACTGTGAATAAATAAGCATGATGAAGCTATTGAATCT
CAAATCTTGAAAAGAAACCCTAATCTACTTTGCTAATGATGATGCCTTGGTATAAAAGAAGGCTTGATGAACGAAAGTGGTGAGATTAGGGGATCGGGTG
CCACGTTCCGGTACCAGGATAGAATATGGATCAGGTGTCACGTTCCGACACCGGGATAGAATATGGATCGGGTGTCACATTCCGACACCAGGATAGAATA
TGGATCGGGTGCCACGTTCCGGTACCAGGATAGTATATGAGGATCGGAGTGTCACGTTCCGACACCAGGATAGAATATGGATCGGGTGCCATGTTCCGGT
ACCAGGATAGTATATGAGGATCGGAGTGTCACGTTCCGACACCAGGATAGTATATTGAGGAGCGGAGTGTCACGTACCGACACGAGGGGAATAAAGATAA
TGAATCTTGAAATATGTTAATATATCCAATCTAATGAACTAAATTCCCAAATGAGTATGATGAGGAGGTGTGAGTCCTCATTGATGTGCTTGGTGTTGTA
AACCAAGGGTTATGGTAACTGTAAAATGCTGCATGCCAA
>LE_HBa0002H14_SP6_52970 (trimmed for quality and cloning vector)
TTGATTCACTCTTCGGTGGAGGTAGGTTATGGTTATTTTCATGCTATTCGTAGTAAACTCTTAATAGTGAATGATATGTGTTAGTAGTATTGTAAACCTT
CTATATGCTTAATTGTATGCTTGCATGAATGATGTGATTATGTAACTGTGAATAAATAAGCATGATGAAGCTATTGAATCTCAAATCTTGAAAAGAAACC
CTAATCTACTTTGCTAATGATGATGCCTTGGTATAAAAGAAGGCTTGATGAACGAAAGTGGTGAGATTAGGGGATCGGGTGCCACGTTCCGGTACCAGGA
TAGAATATGGATCAGGTGTCACGTTCCGACACCGGGATAGAATATGGATCGGGTGTCACATTCCGACACCAGGATAGAATATGGATCGGGTGCCACGTTC
CGGTACCAGGATAGTATATGAGGATCGGAGTGTCACGTTCCGACACCAGGATAGAATATGGATCGGGTGCCATGTTCCGGTACCAGGATAGTATATGAGG
ATCGGAGTGTCACGTTCCGACACCAGGATAGTATATTGAGGAGCGGAGTGTCACGTACCGACACGAGGGGAATAAAGATAATGAATCTTGAAATATGTTA
ATATATCCAATCTAATGAACTAAATTCCCAAATGAGTATGATGAGGAGGTGTGAGTCCTCATTGATGTGCTTGGTGTTGTAAAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.968722
Expected error %
0.266345
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0002H14
Clone
Clone name
hba-2h14
LE_HBa0002H14
C03HBa0002H14
P002H14
Clone type
BAC
Contamination
none
Estimated length
108,408
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found