Clone Read LE_HBa0002H14_T7_52971

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0002H14_T7_52971
Primer
T7
ID from Seq. Facility
LE_HBa_002_H14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
629 trimmed for vector and quality, 816 raw
Genbank Accession
Sequence
>LE_HBa0002H14_T7_52971 (raw untrimmed)
ACCTCGGTCCCGGGGCTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGTTGGTTTAGCCAGCTACTACCGTCGATTTGTCAAGGGATTCTCTTCTAT
TGCTTCCTAATTGACGAACTTGACTAAGCAGAATGTTCCATTTATATGGTCGGATGAATGTGAAGAAAGCTTTCAGGAACTCAAGACCTTGCTGACTACT
GCACCTATCCTTACCTTGCCAGTGGAAGGAAAGAACTTCGTTGTTTATTGTGATGCATCCTATTCTGGTTTGAGTGCAGTGCTAATGCAAGAGAAGAGTG
TAATTGCTTATGCTTCGAGGCAATTAAAGGTGCATGAACATAATTATCCTACCCATGATTTGGAGTTGGCTGCGGTAGTGTTTGCATTAAAGCAATGGAG
ACATTATCTATATGGGGTGAAGTGTGAAGTCTATACAGATCATCGTAGTTTACAGAATGTCTTTACTCAGAAAGATTTGAACTTGAGACAGAGGAGATGG
ATGGAACTACTGAAGGATTATGATGTTACCATCTTGTATCACCCAGGAAAGGCTAATGTTGTGGCAGACGCCTTAAGTAGAAAAGCAGGGAGCATGGGTA
GTTTAGCCCACTTACAAGCTTCTAGAAGCCCATTGGCTAGAGAGGTTCAGACTCTAGCTAACGACTTTTATGAGGTTAAAAGTTAATGAGAAGGGAAGAT
TTTTGGCCCGTGTGGATGCGAGATCTTCTTTTTCTTGCAAGATCAAGGGAAAAACAGTTTGATGATGAAAAACTAAGCCGAATTTCTAAATAATGGTGTT
CCGAGGGAAAGGTTAT
>LE_HBa0002H14_T7_52971 (trimmed for quality and cloning vector)
AGCTTTGTTGGTTTAGCCAGCTACTACCGTCGATTTGTCAAGGGATTCTCTTCTATTGCTTCCTAATTGACGAACTTGACTAAGCAGAATGTTCCATTTA
TATGGTCGGATGAATGTGAAGAAAGCTTTCAGGAACTCAAGACCTTGCTGACTACTGCACCTATCCTTACCTTGCCAGTGGAAGGAAAGAACTTCGTTGT
TTATTGTGATGCATCCTATTCTGGTTTGAGTGCAGTGCTAATGCAAGAGAAGAGTGTAATTGCTTATGCTTCGAGGCAATTAAAGGTGCATGAACATAAT
TATCCTACCCATGATTTGGAGTTGGCTGCGGTAGTGTTTGCATTAAAGCAATGGAGACATTATCTATATGGGGTGAAGTGTGAAGTCTATACAGATCATC
GTAGTTTACAGAATGTCTTTACTCAGAAAGATTTGAACTTGAGACAGAGGAGATGGATGGAACTACTGAAGGATTATGATGTTACCATCTTGTATCACCC
AGGAAAGGCTAATGTTGTGGCAGACGCCTTAAGTAGAAAAGCAGGGAGCATGGGTAGTTTAGCCCACTTACAAGCTTCTAGAAGCCCATTGGCTAGAGAG
GTTCAGACTCTAGCTAACGACTTTTATGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.973783
Expected error %
0.187221
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 298 E Value 5e-80 Identity 23.50% Align. Length 617bp (98.09%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 292 E Value 5e-78 Identity 23.00% Align. Length 617bp (98.09%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0002H14
Clone
Clone name
hba-2h14
LE_HBa0002H14
C03HBa0002H14
P002H14
Clone type
BAC
Contamination
none
Estimated length
108,408
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found