Clone Read LE_HBa0002J08_T7_53055

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0002J08_T7_53055
Primer
T7
ID from Seq. Facility
LE_HBa_002_J08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
692 trimmed for vector and quality, 817 raw
Genbank Accession
Sequence
>LE_HBa0002J08_T7_53055 (raw untrimmed)
CTACCTCGGTACCGGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCATGTTAGACTGGAGCTGGAGCTCCTTATGACGTATCTTCGGGATTGA
GGGAGCTTTGGCAAACACCAGCAATACAGATGGATGCGGAACAAGGTTCTAGACAAAAGTTAATTGGTTCAAAACAACATGAACTCATACTCAGCATCCG
CCACCAACCACATACATTAAATATGACAATTAATCCAGGGAATATACTTTTTCACGCTCCAACTCTATGATCAAGATGCACATGGAAAGAATGTGATTAT
AATTGATAATCATAAAGTTCCGATTTACAAAACGTGGTAATTGAGATGCAGCTTAAGGAAGAAGGTGAGAATATTACCTAGGGTGCGGAGAACCTTTGAT
CGGCTTTTGTCCATACTTTCTCCAAGAATACTCATCGGAAGGAATATCACCTAGCTTGTTGCTTACCGCAGGTATTTTGATTGATCTCTTTACTCTGTGT
TTCCTATATGAAGACAATTCCAAAGTTCTTAATCACCTACAAGACATTATATGATTAAAAAGGAAACAAATCTAAAAGCAAGATAAAATACAAACCTCTT
CTTTGAACAGTGACATCTTCCACTGCTTCCACATTTTCCGCTTCCCTCGTCTCCCCTTCCTGAGCACTTCCTCTTGTGTTGGAATGAGCTCAGATCCGCT
GAGTGTGAAGCCCCAATTAAATGAAAGCTATTACCATTAGCAACGCTACCGTTCACACTCCATGAGGATATAAATGACCTAAGACAAAAAATCGTCCGAA
TACCTGGTCGAGCTATA
>LE_HBa0002J08_T7_53055 (trimmed for quality and cloning vector)
AGCTTTCATGTTAGACTGGAGCTGGAGCTCCTTATGACGTATCTTCGGGATTGAGGGAGCTTTGGCAAACACCAGCAATACAGATGGATGCGGAACAAGG
TTCTAGACAAAAGTTAATTGGTTCAAAACAACATGAACTCATACTCAGCATCCGCCACCAACCACATACATTAAATATGACAATTAATCCAGGGAATATA
CTTTTTCACGCTCCAACTCTATGATCAAGATGCACATGGAAAGAATGTGATTATAATTGATAATCATAAAGTTCCGATTTACAAAACGTGGTAATTGAGA
TGCAGCTTAAGGAAGAAGGTGAGAATATTACCTAGGGTGCGGAGAACCTTTGATCGGCTTTTGTCCATACTTTCTCCAAGAATACTCATCGGAAGGAATA
TCACCTAGCTTGTTGCTTACCGCAGGTATTTTGATTGATCTCTTTACTCTGTGTTTCCTATATGAAGACAATTCCAAAGTTCTTAATCACCTACAAGACA
TTATATGATTAAAAAGGAAACAAATCTAAAAGCAAGATAAAATACAAACCTCTTCTTTGAACAGTGACATCTTCCACTGCTTCCACATTTTCCGCTTCCC
TCGTCTCCCCTTCCTGAGCACTTCCTCTTGTGTTGGAATGAGCTCAGATCCGCTGAGTGTGAAGCCCCAATTAAATGAAAGCTATTACCATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.971383
Expected error %
1.7366
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g28650.1 Score 87 E Value 7e-26 Identity 81.20% Align. Length 361bp (52.17%) Frame 2
68418.m03508 WRKY family transcription factor DNA-binding protein WRKY3, parsley, PIR:S72445
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g04670.1 Score 87 E Value 2e-25 Identity 81.20% Align. Length 361bp (52.17%) Frame 2
68416.m00500 WRKY family transcription factor similar to elicitor response element binding protein WRKY3 isolog GB:AAB63078 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_198217.1| Score 87 E Value 3e-24 Identity 81.20% Align. Length 361bp (52.17%) Frame 2
WRKY family transcription factor [Arabidopsis thaliana] gb|AAL35291.1| WRKY transcription factor 74 [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAL29432.1| Score 87 E Value 3e-24 Identity 81.20% Align. Length 361bp (52.17%) Frame 2
WRKY transcription factor 74 [Arabidopsis thaliana] sp|Q93WU6|WRK74_ARATH Probable WRKY transcription factor 74 (WRKY DNA-binding protein 74)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0002J08
Clone
Clone name
hba-2j8
LE_HBa0002J08
P002J08
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found