Clone Read LE_HBa0002M15_SP6_53212

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0002M15_SP6_53212
Primer
SP6
ID from Seq. Facility
LE_HBa_002_M15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
779 trimmed for vector and quality, 802 raw
Genbank Accession
Sequence
>LE_HBa0002M15_SP6_53212 (raw untrimmed)
CCAGTTAATTCTCAGATCTGTTCATATAATAGCTTTCAACAACGAAAAATATCTATTTTCATCATCACTCGAGTTGTTAACCAAGAAGGCTATTGAAAAC
GCAACTCAGTGGATTGGAACGAATTTTATTGCTGGTGGTGGCACAAATATTTTGAATCCATTGACTCAGGTCACATACCCCTTTTTTTAGATAACTGTCT
CAGTTATATTATTTTTTTTCATCTATTTAGTTAGTTGCAAACTTTATTTTTTGTATGTTAATCGTCTCATCTATTGATTCGGGAGTAGATGATCTATATC
TCAGATAGTATCAAGCTTCTATTTTTTGTGAAAAACATGAAGAATGAAAAGAAAATATATCAGTGGTCACATTTTGGTCCACCATTTTTAGATGTTCACG
GTCAATCATCCTCTCTCAGTGTGTGAGATGCTACTTAGTGACACTGGTTTCATCCCAAAAATATCTTTAGGACACTTGAGGGTCTAGTTGTTAGTTGAAT
ATCATTTGTTGAGCATTTGGAAAGGAGTTACTAATATCCTTTTTTCTTTTCCACAAGTAGATAAATGAAAAAAAAAACATGTGGTCAATCTCTTAAAAGA
AGTGTTAACAACAACGTACATTCATCCTCGCCGCTTACTATTTTATTCCTAGAATGTTGAGTTCATGATATTGAAGTCCTACTGAATTCATAGATTTTTA
TCCTACCTGTATTTTCTGTCAAATCTAACACAAAACTTTTACCTTTATCAGGCCATGGAGATGTTTTCCTATACCCAGCAACACATTCCAATGATTTTCC
TG
>LE_HBa0002M15_SP6_53212 (trimmed for quality and cloning vector)
TGTTCATATAATAGCTTTCAACAACGAAAAATATCTATTTTCATCATCACTCGAGTTGTTAACCAAGAAGGCTATTGAAAACGCAACTCAGTGGATTGGA
ACGAATTTTATTGCTGGTGGTGGCACAAATATTTTGAATCCATTGACTCAGGTCACATACCCCTTTTTTTAGATAACTGTCTCAGTTATATTATTTTTTT
TCATCTATTTAGTTAGTTGCAAACTTTATTTTTTGTATGTTAATCGTCTCATCTATTGATTCGGGAGTAGATGATCTATATCTCAGATAGTATCAAGCTT
CTATTTTTTGTGAAAAACATGAAGAATGAAAAGAAAATATATCAGTGGTCACATTTTGGTCCACCATTTTTAGATGTTCACGGTCAATCATCCTCTCTCA
GTGTGTGAGATGCTACTTAGTGACACTGGTTTCATCCCAAAAATATCTTTAGGACACTTGAGGGTCTAGTTGTTAGTTGAATATCATTTGTTGAGCATTT
GGAAAGGAGTTACTAATATCCTTTTTTCTTTTCCACAAGTAGATAAATGAAAAAAAAAACATGTGGTCAATCTCTTAAAAGAAGTGTTAACAACAACGTA
CATTCATCCTCGCCGCTTACTATTTTATTCCTAGAATGTTGAGTTCATGATATTGAAGTCCTACTGAATTCATAGATTTTTATCCTACCTGTATTTTCTG
TCAAATCTAACACAAAACTTTTACCTTTATCAGGCCATGGAGATGTTTTCCTATACCCAGCAACACATTCCAATGATTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.942343
Expected error %
0.199118
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0002M15
Clone
Clone name
hba-2m15
LE_HBa0002M15
C07HBa0002M15
P002M15
Clone type
BAC
Contamination
none
Estimated length
131,739
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found