Clone Read LE_HBa0002M15_T7_53213

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0002M15_T7_53213
Primer
T7
ID from Seq. Facility
LE_HBa_002_M15-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
716 trimmed for vector and quality, 799 raw
Genbank Accession
Sequence
>LE_HBa0002M15_T7_53213 (raw untrimmed)
AACTGGGTACCGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGAAATAGCCAACACTGCCCTCTCAAATGCCGCCGTATTCAATGTAACTC
CGTCACCAACCCCTCCAAACTCCGTCAAATTAAACGCCACCGTCCTCAGCTTCGGCATCTCCCTCACCGGAAAATCCCGCCGGAAAAACAAGATTCCGGT
GGTAGCATCCTTTTGCCAGAATAGAACAGAAAATATAACGGCGATCCATAGAATAGTCAAAAGGGTTTTGGGGTTAGAGAACAGTGACGTGATCCATGGA
CGTGGGTGGTGAAATTGAGACCACCGGGATGAAGACGATGGTGTTAGAGTCTCAACCATAATGTAGAAAATTCGAATTTTTTCAAAGTGTGGATAGGAGA
AATGTGATTGTGTGCATGAAAGTATATTAGCAAAAAACAATAATATGAAGTGAATTATGAATTTGGAAGGTGAAGTGTAGCAGTCTGGATCAGTGAGGGG
TTAGGTAAATGTTGATGAATTGCATTCTAAGCAAGTATTGCCTTAATTTGAAAACAGTTGGTGTTATGTTCTTTTTTGTTCTACTTGCTGACAATTTGCC
CTAATTAAAAGACATGTTCCATTATAATTATAATATTTGTTAATGTAATATAGTTTTAATTTTTTAAAAAATACTTCTCTGTCAACTTAATTATGAAAAA
GAGTCAAAAATATCATTCTATTTTTATTTATTGATTAATATTTTTCCCTAATTATATTAAAAAGCTAACAGATTCCCTCCATGTTATTACCCAATTTTA
>LE_HBa0002M15_T7_53213 (trimmed for quality and cloning vector)
AGCTTAGAAATAGCCAACACTGCCCTCTCAAATGCCGCCGTATTCAATGTAACTCCGTCACCAACCCCTCCAAACTCCGTCAAATTAAACGCCACCGTCC
TCAGCTTCGGCATCTCCCTCACCGGAAAATCCCGCCGGAAAAACAAGATTCCGGTGGTAGCATCCTTTTGCCAGAATAGAACAGAAAATATAACGGCGAT
CCATAGAATAGTCAAAAGGGTTTTGGGGTTAGAGAACAGTGACGTGATCCATGGACGTGGGTGGTGAAATTGAGACCACCGGGATGAAGACGATGGTGTT
AGAGTCTCAACCATAATGTAGAAAATTCGAATTTTTTCAAAGTGTGGATAGGAGAAATGTGATTGTGTGCATGAAAGTATATTAGCAAAAAACAATAATA
TGAAGTGAATTATGAATTTGGAAGGTGAAGTGTAGCAGTCTGGATCAGTGAGGGGTTAGGTAAATGTTGATGAATTGCATTCTAAGCAAGTATTGCCTTA
ATTTGAAAACAGTTGGTGTTATGTTCTTTTTTGTTCTACTTGCTGACAATTTGCCCTAATTAAAAGACATGTTCCATTATAATTATAATATTTGTTAATG
TAATATAGTTTTAATTTTTTAAAAAATACTTCTCTGTCAACTTAATTATGAAAAAGAGTCAAAAATATCATTCTATTTTTATTTATTGATTAATATTTTT
CCCTAATTATATTAAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.956049
Expected error %
0.37677
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g19170.1 Score 89 E Value 2e-18 Identity 17.00% Align. Length 311bp (43.44%) Frame 1
68414.m02386 glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein low similarity to SP|P27644 Polygalacturonase (EC 3.2.1.15) (Pectinase) {Agrobacterium tumefaciens}; contains PF00295: Glycosyl hydrolases family 28
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g42950.1 Score 69 E Value 2e-12 Identity 16.30% Align. Length 245bp (34.22%) Frame 1
68416.m04511 glycoside hydrolase family 28 protein / polygalacturonase (pectinase) family protein weak similarity to polygalacturonase precursor [Cucumis melo] GI:3320460; contains PF00295: Glycosyl hydrolases family 28
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||B86325 Score 89 E Value 1e-16 Identity 17.00% Align. Length 311bp (43.44%) Frame 1
T29M8.4 protein - Arabidopsis thaliana gb|AAF82228.1| Contains similarity to a polygalacturonase-like protein gi|7529266 from Arabidopsis thaliana BAC F18P9 gb|AL138654 and contains multiple polygalacturonase (pectinase) PF|00295 domains
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN15350.1| Score 89 E Value 1e-16 Identity 17.00% Align. Length 311bp (43.44%) Frame 1
unknown protein [Arabidopsis thaliana] gb|AAL91166.1| unknown protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0002M15
Clone
Clone name
hba-2m15
LE_HBa0002M15
C07HBa0002M15
P002M15
Clone type
BAC
Contamination
none
Estimated length
131,739
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found