Clone Read LE_HBa0002N12_T7_53255

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0002N12_T7_53255
Primer
T7
ID from Seq. Facility
LE_HBa_002_N12-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
705 trimmed for vector and quality, 787 raw
Genbank Accession
Sequence
>LE_HBa0002N12_T7_53255 (raw untrimmed)
AACTTGGATCCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGTTTCAACTAAACAAACGACAAAGTGTACAAAACAAACTAATGCCTCTA
CATGACTAGTCTTTCTATATAACGATAAATGTCTTTGATATTGGGAGATTCCTAGTTCTCTCCAAATCTTTGTATTCATATCATAACAAGATAGATTTCC
TGATCTATTATGATACTGTTCCCACGGAAGTATTGTCTTGCAGTATCATACTTGTACTAGGCACACGTAATTTTATTAGTATATGATATAAAATAAAATA
TGTTGATATAATGTTATGATAGTTATTCTAAAACAAAATCATATGCAAAATGCTATTACAAAAAAAAAAGATTTTGTTTAGGGATTTAAAACAGGAAGAA
GAATCTGATATACCCCTCAACTTTATCATTTAGAGCTGATATACCCCTCGTTATAAAAGTGACTCATATATTCCTTTACCGTTATACAAACGACTCACAT
ATACCCTTCATTTAACGGAAGTCAAAAAAATAGTTTTAAATTCATATTTATTACTTCTAATTTTTTTTAAAAAATTATTTAGGAGTATATATGATTCTTC
TATCAAAGTTCAAGTTATATTTTAATTTTTTTCATACATAAATTATTTTTTGACTTCTTTTATTATAATTATTTGAGTTTCTTATTCTTATTTTGTTTTT
GTCCTTCATTCCTTAGTTTAAAAAATAAAAATTTTAATTATTTTTTTTGTGGTTTGTAATTTAATTTCTTATTCGAAGAAAAAATTT
>LE_HBa0002N12_T7_53255 (trimmed for quality and cloning vector)
AGCTTTGTTTCAACTAAACAAACGACAAAGTGTACAAAACAAACTAATGCCTCTACATGACTAGTCTTTCTATATAACGATAAATGTCTTTGATATTGGG
AGATTCCTAGTTCTCTCCAAATCTTTGTATTCATATCATAACAAGATAGATTTCCTGATCTATTATGATACTGTTCCCACGGAAGTATTGTCTTGCAGTA
TCATACTTGTACTAGGCACACGTAATTTTATTAGTATATGATATAAAATAAAATATGTTGATATAATGTTATGATAGTTATTCTAAAACAAAATCATATG
CAAAATGCTATTACAAAAAAAAAAGATTTTGTTTAGGGATTTAAAACAGGAAGAAGAATCTGATATACCCCTCAACTTTATCATTTAGAGCTGATATACC
CCTCGTTATAAAAGTGACTCATATATTCCTTTACCGTTATACAAACGACTCACATATACCCTTCATTTAACGGAAGTCAAAAAAATAGTTTTAAATTCAT
ATTTATTACTTCTAATTTTTTTTAAAAAATTATTTAGGAGTATATATGATTCTTCTATCAAAGTTCAAGTTATATTTTAATTTTTTTCATACATAAATTA
TTTTTTGACTTCTTTTATTATAATTATTTGAGTTTCTTATTCTTATTTTGTTTTTGTCCTTCATTCCTTAGTTTAAAAAATAAAAATTTTAATTATTTTT
TTTGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.898448
Expected error %
0.390788
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0002N12
Clone
Clone name
hba-2n12
LE_HBa0002N12
P002N12
Clone type
BAC
Contamination
none
Estimated length
114,298
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found