Clone Read LE_HBa0003C18_SP6_53506

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0003C18_SP6_53506
Primer
SP6
ID from Seq. Facility
LE_HBa_003_C18-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
711 trimmed for vector and quality, 803 raw
Genbank Accession
Sequence
>LE_HBa0003C18_SP6_53506 (raw untrimmed)
GAATGATTGGATTTTCCATCACGATCTCAAGCCTTCCAGTGTGAGCAGTTACTCATTATTTGGACTAACAACTTCATGAAGTAGAAAAATTGTTCACTTG
AAGAATTAGCTTTTTGACATTTAAGCGATCTCGCTCCATCCTTCCCTCTATTTCTTTACTATACTTGTACATACTGTTATATTCCTACGAACCCCAATCC
AAACACCATCATCTAACCTATGATTAGTTTCACTACATCAAGCAGATCAGTTTAAGAAGCATTCGCCTCATGAATATTATTCATCAAACTAACAAGTGCC
TTACCAAGCAAGAATATTAATGTACAGGAAAAGAAAAGAAAATCTAACGACTAATCAAGGGGGATATCAAAGAACCAGTAAGTGTAGGCAAGTTCATTAC
TCCTGTAATATATATAAGACAACCAAAGCCAATGAAAAAATTACCGACGATAAAGACGTTTTGGGTTAATGTTCTTTCGAAGCACCACTCGTTCTTGTAA
ACCTCCCCAATATGGAAGAGTTTTTAGATCAGGGCAGAAACGACCAATTTCATCGGCCCAGTTATTCAAGACTGATGCGGGAGCAACAACTAAAAAGGGA
CCCCATATATTCTTTTCCTGCAGAGATCAATGAAGTCAAGTTGCTAGATACTCTACCAAACAGTTTCTTGATTTGATAATTTACTACAAGAAAGTGGTAA
ATAAAACATGAACTAAATCGCTTACTTCTGCCAAATGAACCAAGAAAGCCATGGCCTGGATTGTTTTCCCAAGACCCATCTCATCAGCAAGAATGGCCAT
TTA
>LE_HBa0003C18_SP6_53506 (trimmed for quality and cloning vector)
TCACGATCTCAAGCCTTCCAGTGTGAGCAGTTACTCATTATTTGGACTAACAACTTCATGAAGTAGAAAAATTGTTCACTTGAAGAATTAGCTTTTTGAC
ATTTAAGCGATCTCGCTCCATCCTTCCCTCTATTTCTTTACTATACTTGTACATACTGTTATATTCCTACGAACCCCAATCCAAACACCATCATCTAACC
TATGATTAGTTTCACTACATCAAGCAGATCAGTTTAAGAAGCATTCGCCTCATGAATATTATTCATCAAACTAACAAGTGCCTTACCAAGCAAGAATATT
AATGTACAGGAAAAGAAAAGAAAATCTAACGACTAATCAAGGGGGATATCAAAGAACCAGTAAGTGTAGGCAAGTTCATTACTCCTGTAATATATATAAG
ACAACCAAAGCCAATGAAAAAATTACCGACGATAAAGACGTTTTGGGTTAATGTTCTTTCGAAGCACCACTCGTTCTTGTAAACCTCCCCAATATGGAAG
AGTTTTTAGATCAGGGCAGAAACGACCAATTTCATCGGCCCAGTTATTCAAGACTGATGCGGGAGCAACAACTAAAAAGGGACCCCATATATTCTTTTCC
TGCAGAGATCAATGAAGTCAAGTTGCTAGATACTCTACCAAACAGTTTCTTGATTTGATAATTTACTACAAGAAAGTGGTAAATAAAACATGAACTAAAT
CGCTTACTTCT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.958329
Expected error %
0.102357
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g57300.1 Score 125 E Value 3e-29 Identity 28.50% Align. Length 206bp (28.97%) Frame 1
68416.m06378 transcriptional activator, putative similar to transcriptional activator SRCAP [Homo sapiens] GI:5106572; contains Pfam profiles PF00271: Helicase conserved C-terminal domain, PF00176: SNF2 family N-terminal domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_191289.2| Score 125 E Value 1e-27 Identity 28.50% Align. Length 206bp (28.97%) Frame 1
transcriptional activator, putative [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAB68136.1| Score 125 E Value 1e-27 Identity 28.50% Align. Length 206bp (28.97%) Frame 1
helicase-like protein [Arabidopsis thaliana] pir||T45808 helicase-like protein - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0003C18
Clone
Clone name
hba-3c18
LE_HBa0003C18
P003C18
Clone type
BAC
Contamination
none
Estimated length
84,591
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found