Clone Read LE_HBa0003C18_T7_53507

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0003C18_T7_53507
Primer
T7
ID from Seq. Facility
LE_HBa_003_C18-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
744 trimmed for vector and quality, 805 raw
Genbank Accession
Sequence
>LE_HBa0003C18_T7_53507 (raw untrimmed)
GCTTGGGTCCCGTGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTCTTGAATAGACTTCACTTTTTCCATCGAATCCCTCAAGAGATCAGTAC
CCCAAGGTCTAACCTCAAACGCATCAAACCAACCAATGGGAGACCTACATCTCCTACCATACAATGCTTCAAATGGAGCCATATCAATGCTTGAGTGATA
GCTATTATTGTATGAAAACTCCGCTAAGGGTAAGAAGCTATCCCAATGGCCACCAAACTCTATCACACATGCACGAAGCATATCTTCCAACACTTGAATC
GTTCGCTTAGACTGACCATCGGTCTGGGGATGGAACGCAGTACTAAGGTCCAACCAAGTACCCAATTCTGCATGCAATGTTTTCCAAAACTTAGAAGTAA
ACTGCGTACCTCTATCTGATATGATGAATAGTGGAACCCCATGCAATCGCACCACTTCCGAGATGTAAAGTCTGGCTAACTTCTCTGCATTGTAAGTCAC
CTTGACCGGAATGAAGTGAGCAGACTTAGTTAACCTATCAACAATTACCCAAATAGAATCATACTTACCCATTGTCTTCGAAAGACCAACAACAAAATCC
ATTGCAATTCTTTCCCACTTCCATTCCGGAATGGGCATTCTCTGAAGTGTTCCTCCGGGCCTTTGGTGTTCACACTTTACTTGTTGACAGTTTGGACACT
TGGCAATAAAATCCACAAATATCACGCTTCATTCTACTCCACCAAAAGTGTTGCTTTAGGTCACGGTACATCTTGGGTTCCCCCGGATGTTACGAATACC
TTGAA
>LE_HBa0003C18_T7_53507 (trimmed for quality and cloning vector)
AGCTTTTCTTGAATAGACTTCACTTTTTCCATCGAATCCCTCAAGAGATCAGTACCCCAAGGTCTAACCTCAAACGCATCAAACCAACCAATGGGAGACC
TACATCTCCTACCATACAATGCTTCAAATGGAGCCATATCAATGCTTGAGTGATAGCTATTATTGTATGAAAACTCCGCTAAGGGTAAGAAGCTATCCCA
ATGGCCACCAAACTCTATCACACATGCACGAAGCATATCTTCCAACACTTGAATCGTTCGCTTAGACTGACCATCGGTCTGGGGATGGAACGCAGTACTA
AGGTCCAACCAAGTACCCAATTCTGCATGCAATGTTTTCCAAAACTTAGAAGTAAACTGCGTACCTCTATCTGATATGATGAATAGTGGAACCCCATGCA
ATCGCACCACTTCCGAGATGTAAAGTCTGGCTAACTTCTCTGCATTGTAAGTCACCTTGACCGGAATGAAGTGAGCAGACTTAGTTAACCTATCAACAAT
TACCCAAATAGAATCATACTTACCCATTGTCTTCGAAAGACCAACAACAAAATCCATTGCAATTCTTTCCCACTTCCATTCCGGAATGGGCATTCTCTGA
AGTGTTCCTCCGGGCCTTTGGTGTTCACACTTTACTTGTTGACAGTTTGGACACTTGGCAATAAAATCCACAAATATCACGCTTCATTCTACTCCACCAA
AAGTGTTGCTTTAGGTCACGGTACATCTTGGGTTCCCCCGGATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.973182
Expected error %
0.468226
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 353 E Value 1e-105 Identity 72.50% Align. Length 741bp (99.60%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 349 E Value 1e-103 Identity 72.10% Align. Length 741bp (99.60%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0003C18
Clone
Clone name
hba-3c18
LE_HBa0003C18
P003C18
Clone type
BAC
Contamination
none
Estimated length
84,591
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found