Clone Read LE_HBa0003C20_T7_53511

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0003C20_T7_53511
Primer
T7
ID from Seq. Facility
LE_HBa_003_C20-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
412 trimmed for vector and quality, 800 raw
Genbank Accession
Sequence
>LE_HBa0003C20_T7_53511 (raw untrimmed)
AATATTGTTCTTTTTTATTATATGAGTGAGTACAGTGATGCGGAAAATGTGAGATTGTGGAGCTTGATTACCATTTAATATATTGTTATATATTAATGTT
CTTGTGATTGAACCCCTAATACGCTGAATTAAGTTTACTCACGGGGTGTTACCACGAAATATTGGTTTCATTCTTTCTGTCTCTAGATCTCTCTCTCGAA
AGTTCTTGTGTTCTTCATTCATCAAGTGTGTGTGTGAATTCGATCATAACAGTAAAGTTTATATATTTTTTTATGATATAGATAATACTTATTCGTGCTA
GATGACCTAAAATTTGAGAAGGTGTTAATTATTCTTTATTAACGTTTTGAATTATCATTGTTATGCCTTTGTTTAACTAACATCACATGAAATTTGAAAA
TTTATTGCGATAAATGCCTTATTCAATCACAAATTCTATATAATAAACTCTTTTTTATGCGCGATTTTCTATTAAATGAGTCTCACTTGATATGAATATG
AATTAGTAGTGTTAATAAAGTCCCAAATCCCTTAAAGATATTTGTTAAGCCGAAACTTTAATTTGCATTGAACGACTTTACTATAAATTTATCAGAAATA
GGAATACACATTTCATAAAAATGATCATCTTGATTTAATATTAGTTTGTTGATTTTTGGGATTGATATTTGGATTAAAGATGATTTAATTTAACTTTTTT
CATTCCTATATTTGGTCTAAAATTTTAATTTTATAGGAATGGGTATGAAAATTTATAGTGTAATTTTTAGTTATAATCTTACTAAGGCCTCTACAATTTT

>LE_HBa0003C20_T7_53511 (trimmed for quality and cloning vector)
ATATTGTTATATATTAATGTTCTTGTGATTGAACCCCTAATACGCTGAATTAAGTTTACTCACGGGGTGTTACCACGAAATATTGGTTTCATTCTTTCTG
TCTCTAGATCTCTCTCTCGAAAGTTCTTGTGTTCTTCATTCATCAAGTGTGTGTGTGAATTCGATCATAACAGTAAAGTTTATATATTTTTTTATGATAT
AGATAATACTTATTCGTGCTAGATGACCTAAAATTTGAGAAGGTGTTAATTATTCTTTATTAACGTTTTGAATTATCATTGTTATGCCTTTGTTTAACTA
ACATCACATGAAATTTGAAAATTTATTGCGATAAATGCCTTATTCAATCACAAATTCTATATAATAAACTCTTTTTTATGCGCGATTTTCTATTAAATGA
GTCTCACTTGAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.907871
Expected error %
0.592143
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0003C20
Clone
Clone name
hba-3c20
LE_HBa0003C20
C05HBa0003C20
P003C20
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found