Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0003O02_SP6_54050

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0003O02_SP6_54050
Primer
SP6
ID from Seq. Facility
LE_HBa_003_O02-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
625 trimmed for vector and quality, 769 raw
Genbank Accession
Sequence
>LE_HBa0003O02_SP6_54050 (raw untrimmed)
ACTCCGGGGCCCGGGCCAGCATCGTGATGTGCTTTGTTTATCTCCTTTTATGAATCCTCCCTTATGTTGTGCTATGCATGCTGCATTATCTTCATATAAA
GTGGTGGGTACTTTATCACATTTCAAACCACATTTCTCTCGAATGAGATGTATCATAGACCTTAACTACACACATTCTCTACTTGCTTCATGAATAGCTA
TTATTTCAGCATGATTAGATGAAGTGGCTACGATGGACTGCTTTGTAGATCTCCAAGATATGGCAGTCCCCCCACATATAAACACATAGCCTGTTTGGGA
TCGAGCTTTGTGTGGATCAGATAAATATCTTGCATTAGCATAACCAACAAGATTTGGGCTACAATTAACAAAATAAAATAAGCCCATATCAGTTGTCCCT
TTAAGATATCGCAAAATGTGTTTGATTCCATTCCAATGTCTCCTAGTAGGAGCAGAACTATACCTTGCTAACAAGTTAACAGCAAAAGCTATATCAGGCC
TTGTAGTGTTAGCAAGATACATTAGTGCACCAATTGCACTAAGATATGGTACTTCAGAACCAAGAATTTCTTCATCCTTTTCTTGAGGTCGGAATGGATC
CTTATTCACATCAAGTGAACGAACAACCATCGGAGTACTTAATGGATGCGCTTCATCCATACATAATCTTTTCAACACTTTTTTCTGTGTTAGGCAGATT
GATGAACCAAAATACCCATTTGTCAAATGCTCACATTTGCAAACCAAGAAATAATCTTTGTCCCTCCCG
>LE_HBa0003O02_SP6_54050 (trimmed for quality and cloning vector)
GTGCTTTGTTTATCTCCTTTTATGAATCCTCCCTTATGTTGTGCTATGCATGCTGCATTATCTTCATATAAAGTGGTGGGTACTTTATCACATTTCAAAC
CACATTTCTCTCGAATGAGATGTATCATAGACCTTAACTACACACATTCTCTACTTGCTTCATGAATAGCTATTATTTCAGCATGATTAGATGAAGTGGC
TACGATGGACTGCTTTGTAGATCTCCAAGATATGGCAGTCCCCCCACATATAAACACATAGCCTGTTTGGGATCGAGCTTTGTGTGGATCAGATAAATAT
CTTGCATTAGCATAACCAACAAGATTTGGGCTACAATTAACAAAATAAAATAAGCCCATATCAGTTGTCCCTTTAAGATATCGCAAAATGTGTTTGATTC
CATTCCAATGTCTCCTAGTAGGAGCAGAACTATACCTTGCTAACAAGTTAACAGCAAAAGCTATATCAGGCCTTGTAGTGTTAGCAAGATACATTAGTGC
ACCAATTGCACTAAGATATGGTACTTCAGAACCAAGAATTTCTTCATCCTTTTCTTGAGGTCGGAATGGATCCTTATTCACATCAAGTGAACGAACAACC
ATCGGAGTACTTAATGGATGCGCTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.96236
Expected error %
0.172179
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 95 E Value 3e-20 Identity 13.10% Align. Length 473bp (75.68%) Frame 1
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAS79613.1| Score 296 E Value 2e-79 Identity 23.30% Align. Length 608bp (97.28%) Frame 1
putative copia-like polyprotein [Ipomoea trifida]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE01490.1| Score 290 E Value 1e-77 Identity 22.70% Align. Length 602bp (96.32%) Frame 1
P0041A24.2 [Oryza sativa (japonica cultivar-group)] ref|XP_472628.1| P0041A24.2 [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0003O02
Clone
Clone name
hba-3o2
LE_HBa0003O02
C02HBa0003O02
P003O02
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found