Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

Clone Read LE_HBa0003O02_T7_54051

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0003O02_T7_54051
Primer
T7
ID from Seq. Facility
LE_HBa_003_O02-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
699 trimmed for vector and quality, 754 raw
Genbank Accession
Sequence
>LE_HBa0003O02_T7_54051 (raw untrimmed)
AGGCTGGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAACACCAGCAGCGACCATTGCAAGTTCGAGAGAAGACAATTGTCCTGGA
ACGACCTTGTCACCGCGCAGGAAGAAGGTTCCGAGTAGGAACGCTGACGTGATGAAGAAGCCGCTGGAGCACTTGCCTCCGTTGAATGAGGAAGTTTGGA
AGATTGGGGCGAGAAAGGTCGGGACATCGATGAAGAGGCTGCTCCAAGGAAATGATCGAGTACGCGAGTTGATGGTCGCCCAGTAAAACTCAACGCCGAT
ACGAACGCAATTCGACGCGGTCGTCGCATCATCAAGTGGGGGAGTTTGTCACGACCCGCCAGATACCTAGGTAGATCGCGACCCGTCTAGGCAGCCAGCA
GCCTGTGCAAGGGGAATAGACAGCCCAAAACGGCCAGCAAGCAAAGGGGCTAGCATCCAAGCTGGCAGCAGACAGAGGGTCAGGCGTTTCAGCCGTTACA
GGCAGTTTCAGCAGTTATAGCCGTTTCATCAGTTACGACCATTTCATCAGTTATAGCATGTGGGGAGGCGGCAGGTTCCAGCCTTGGAGGGGCTTGTGCT
GGGCCTCTAGAACGTGGGGCAGACTAGGGAGCAGCTAGGAGTCCCTTTTTGGAAAACTTAGAAGCATGTCTTGTGGGCATGGACTTAGGGGATTGTATAT
AGTTTAGTATTTATTTACTCTTATTGTTTAGAGTAGTATAAATAGGTTGCCATT
>LE_HBa0003O02_T7_54051 (trimmed for quality and cloning vector)
AGCTTAACACCAGCAGCGACCATTGCAAGTTCGAGAGAAGACAATTGTCCTGGAACGACCTTGTCACCGCGCAGGAAGAAGGTTCCGAGTAGGAACGCTG
ACGTGATGAAGAAGCCGCTGGAGCACTTGCCTCCGTTGAATGAGGAAGTTTGGAAGATTGGGGCGAGAAAGGTCGGGACATCGATGAAGAGGCTGCTCCA
AGGAAATGATCGAGTACGCGAGTTGATGGTCGCCCAGTAAAACTCAACGCCGATACGAACGCAATTCGACGCGGTCGTCGCATCATCAAGTGGGGGAGTT
TGTCACGACCCGCCAGATACCTAGGTAGATCGCGACCCGTCTAGGCAGCCAGCAGCCTGTGCAAGGGGAATAGACAGCCCAAAACGGCCAGCAAGCAAAG
GGGCTAGCATCCAAGCTGGCAGCAGACAGAGGGTCAGGCGTTTCAGCCGTTACAGGCAGTTTCAGCAGTTATAGCCGTTTCATCAGTTACGACCATTTCA
TCAGTTATAGCATGTGGGGAGGCGGCAGGTTCCAGCCTTGGAGGGGCTTGTGCTGGGCCTCTAGAACGTGGGGCAGACTAGGGAGCAGCTAGGAGTCCCT
TTTTGGAAAACTTAGAAGCATGTCTTGTGGGCATGGACTTAGGGGATTGTATATAGTTTAGTATTTATTTACTCTTATTGTTTAGAGTAGTATAAATAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.98092
Expected error %
0.0888474
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0003O02
Clone
Clone name
hba-3o2
LE_HBa0003O02
C02HBa0003O02
P003O02
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found